Labshake search
Citations for Bio-Rad :
301 - 350 of 8543 citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were visualized with a ChemiDoc MP fluorescent imager (Bio-Rad). Bio-Rad Image Lab analysis software was used to quantify protein band density ...
-
bioRxiv - Physiology 2023Quote: ... The fluorescent signal was measured via a ChemiDoc MP (Bio-Rad).
-
bioRxiv - Biophysics 2023Quote: ... Gels were subsequently stained with Oriole fluorescent gel stain (Bio-Rad) and visualized on a UV transilluminator 2000 (Bio-Rad)
-
bioRxiv - Physiology 2024Quote: ... Fluorescent signals were detected using a ChemiDoc MP imaging system (Biorad).
-
bioRxiv - Molecular Biology 2019Quote: ... The reaction components were prepared as a 2x-master mix and 5 µl of the mix was pipetted into opaque wells of 384-well PCR-plate (Bio-Rad). Then an equal volume of sample was added ...
-
bioRxiv - Plant Biology 2020Quote: ... Plates were incubated for 30 °C for 5 or 7 days and imaged using a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... Chemiluminescence detection was performed using the Amersham ECL Prime Western Blotting Detection System (Cytiva Amersham™) and a ChemiDoc Imager (Bio-Rad) with ImageLab software (version 6.0.1).
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were then subjected to peroxidase-based detection by using enhanced chemiluminescence (ECL) detection reagent (Clarity Max™ Western ECL Substrate, Bio-Rad), and the chemiluminescent signals were visualized by ChemiDoc Touch System (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad). Rpl19 mRNA levels were used for normalization and the ΔΔCt method (70 ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-Time PCR Detection System (Bio-Rad Laboratories, California) was used to detect mRNA expression of target genes ...
-
bioRxiv - Cell Biology 2022Quote: ... on a CFX384 Real-Time PCR Detection system (Biorad). Expression of each gene was normalized to the housekeeping gene ALG9 and expressed as fold change after 1.5h rapamycin treatment calculated using delta-delta Ct method.
-
bioRxiv - Molecular Biology 2021Quote: ... and CFX384 Touch Real-Time PCR Detection Systems (BioRad). Relative levels of transcript expression were quantified by the comparative ΔΔCt method with normalisation to RPL19 levels ...
-
bioRxiv - Neuroscience 2019Quote: ... A CFX connect real-time detection system (Bio-Rad) was used to perform qPCR ...
-
bioRxiv - Immunology 2019Quote: ... The CFX384 TouchTM Real-Time PCR Detection System (BioRad) was used to obtain the raw CT values ...
-
bioRxiv - Systems Biology 2019Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad) were used for quantitative PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in CFX96TM Real-Time PCR Detection system (Bio-Rad). Ribosomal protein S14 (RPS14 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: ... and a Real-Time PCR Detection System (Bio-Rad). The cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). Primer sequences are available upon request.
-
bioRxiv - Microbiology 2021Quote: ... using CFX96 Real-Time PCR Detection System (Bio-Rad) and 500 nM SARS-Cov-2 nsp1-specific CCTCAACTTGAACAGCCCTATG forward and GAATGCCTTCGAGTTCTGCTAC reverse primers.
-
bioRxiv - Biochemistry 2020Quote: ... for detection with the ChemiDocTM XRS+ System (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The CFX96 Real-Time PCR Detection System (Bio-Rad) was used to monitor fluorescent intensity during amplification ...
-
bioRxiv - Plant Biology 2021Quote: ... in a CFX96 Real-Time Detection System (Bio-Rad), using 1 μL of cDNA in a final reaction volume of 10 μL per well ...
-
bioRxiv - Cell Biology 2021Quote: ... Blots were imaged using Western Clarity detection reagent (BioRad) before detection on a BioRad Chemi Doc imaging system with BioRad Image Lab v5.1 software.
-
bioRxiv - Microbiology 2021Quote: ... Detection was performed with ECL (Bio-Rad or Thermo), and images were acquired with a ChemiDoc XRS imaging system (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... in iQ5 Real-Time PCR Detection System (Bio-Rad). A portion of the m-hCDKL5 (Fw 5’-CTTAAATGCAGACACAAGGAAACAC-3 ‘ ...
-
bioRxiv - Microbiology 2020Quote: ... on CFX96 TouchTM Real-Time PCR Detection System (BioRad). The genome sequence of P ...
-
bioRxiv - Cancer Biology 2020Quote: ... on the CFX384 RT-PCR detection system (Bio-Rad). Isoform-specific primers sequences and housekeeping gene primers are shown in the Supplement Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and imaged using the detection solution (BioRad, 170-5061) and ChemiDoc imaging system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... The CFX Connect Real-Time PCR Detection System (BioRad) was used to run RTq-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a Real-Time PCR Detection System (Bio-Rad). Bacterial strains were grown for 2 hours at 37°C under inducing conditions in LB ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). The data were analyzed by the comparative threshold method ...
-
bioRxiv - Physiology 2020Quote: ... real-time detection method (BioRad MyIQ RT-PCR, Thermo).
-
ATM-mediated DNA damage response in macrophages primes phagocytosis and immune checkpoint regulationbioRxiv - Immunology 2020Quote: ... on CFX96TM Real-Time PCR Detection System (Bio-Rad). The cDNA was added to qPCR buffer Master-mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... CFX96 Real-Time PCR detection system (Bio-Rad Laboratories), or CFX384 Real-Time PCR detection system (Bio-Rad Laboratories).
-
bioRxiv - Cancer Biology 2021Quote: Detection was performed using the iQ5 QPCR apparatus (Biorad), using IQ green super mix (Biorad) ...
-
bioRxiv - Microbiology 2022Quote: ... in a CFX96 real-time PCR detection system (BioRad). Specific primers were designed using the PrimerQuest tool (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Systems Biology 2022Quote: ... Real-time sequence detection software (Bio-Rad Laboratories; 1845001) was used to compute Cycle threshold (CT) ...
-
bioRxiv - Physiology 2019Quote: ... on a CFX384 Real-Time PCR Detection system (BioRad). 2.8 ng cDNA was added to each well ...
-
bioRxiv - Cancer Biology 2019Quote: ... and CFX96 Real-Time PCR detection system (Bio-Rad). The primers used for real-time PCR were designed based on the Universal Probe Library (Roche ...
-
bioRxiv - Immunology 2019Quote: ... in CFX96 Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... Protein detection was carried out using chemiluminescence (Bio-Rad) and imaged using a ChemiDoc imaging system (Bio-Rad).
-
bioRxiv - Microbiology 2019Quote: ... and visualized using Western Clarity detection reagent (Bio-Rad). Chemiluminescence was detected using a ChemiDoc Imager System (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... on CFX96 real-time PCR detection system (BIO-RAD). QPCR data were analyzed on CFX manager 3.1 (BIO-RAD).
-
bioRxiv - Neuroscience 2021Quote: ... by CFX384 Touch Real-Time PCR detection system (BioRad). Primers were optimized and designed to hybridize with different exons ...
-
bioRxiv - Microbiology 2021Quote: ... a CFX Connect RealTime PCR Detection system (Bio-Rad) or a 7500 Real Time PCR System (Applied Biosystems).
-
bioRxiv - Microbiology 2020Quote: ... was used for detection with ChemiDoc (Bio-Rad, USA).
-
bioRxiv - Biochemistry 2022Quote: ... A CFX384 Touch Real-Time PCR Detection System (BioRad) was used with the following cycling parameters ...