Labshake search
Citations for Bio-Rad :
101 - 150 of 3014 citations for Glucagon like peptide 1 receptor GLP1R Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Plant Biology 2020Quote: ... Peptide concentration was determined by a modified Lowry procedure using the DC Protein Assay (BioRad; Munich, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: Electrophoresis was used to separate peptides in a 16.5% Mini-PROTEAN® Tris-Tricine Gel (Bio-Rad) with tris-tricine (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: IgE receptor cross-linking (IgECL) on HSMCs was accomplished through sensitization with 1 μg/mL chimeric human IgE anti-NP antibody (MCA333S, BIO-RAD, Hercules, CA) for 24 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... Supernatants were transferred to new tubes and peptide concentrations were quantified using the DC Protein Assay (Bio-Rad). Peptides were labeled using 10-plex TMT reagents as described above and 4 μg of proteins were used for each TMT channel ...
-
bioRxiv - Cancer Biology 2022Quote: ... Supernatants were transferred to new tubes and peptide concentrations were quantified using the DC Protein Assay (Bio-Rad). 50 μg of each sample were set aside for TMT labeling ...
-
bioRxiv - Immunology 2019Quote: ... After quantifying the optimal virus-to-erythrocyte concentration (4HA units), serial two-fold dilutions of Fc, control IVIG (GammaGard, Baxter Healthcare) and polyclonal goat anti-influenza B (Biorad) were prepared ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Cell Biology 2021Quote: ... The N-ter (pI 5.5) and C-ter (pI 9.9) peptides were conjugated to Affi-Gel-10 (Bio-rad) agarose beads for affinity-purification ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.2 μl of the resuspended peptide was spotted on to a nitrocellulose membrane (BIO-RAD, 0.2 μm #162-0112) and left to air-dry ...
-
bioRxiv - Neuroscience 2024Quote: ... Imaging was performed using either an Odyssey Fc imaging system (Li-Cor) (quantified using Image StudioTM software) or a Molecular ChemiDocTM Touch Imaging System (Bio-Rad) (quantified using Image Lab 6.0.1 software).
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Proteins and peptides bearing C-terminal 6xHis tags were detected with mouse anti-6xHis antibody clone AD1.1.10 (BioRad; Cat # MCA1396GA) while detection of glycosylated CRM197-FtO-PS was with anti-F ...
-
bioRxiv - Plant Biology 2019Quote: ... Purity and size of each peptide were determined by electrophoresis on a 4-20% Mini-Protean TGX gels (Bio-Rad). The correct mass of each peptide was confirmed by mass spectrometry prior to its use in experiments described below.
-
bioRxiv - Immunology 2020Quote: ... Cathepsin B activity was determined using Magic Red™ (a cell-permeable and non-cytotoxic reagent that contains a cathepsin B target sequence peptide (RR)2 linked to a red (Cresyl Violet) fluorescent probe) and lysosomes were detected with acridine orange (Biorad), according to manufactures instructions.
-
bioRxiv - Neuroscience 2021Quote: ... and vasopressin) peptides were spotted onto a 0.2-μm polyvinylidene fluoride membrane (Immun-Blot PVDF Membrane for Protein Blotting, BIO-RAD). The membrane was air dried at room temperature and was washed for 10 min in 0.05 M Tris buffer (pH 7.6 ...
-
bioRxiv - Genetics 2023Quote: The expression levels of non-ribosomal peptide synthetase genes were assessed using a real-time amplifier CFX96 (Bio-Rad, USA) and a commercial “PCR-mix SYBR Green I kit” (Syntol ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Immunology 2020Quote: ... and incubated with either FITC-conjugated Sheep Anti-Human C3 (BioRad AHP031F) at 1:500 or AF488-conjugated Mouse Anti-C5b-9 (ae11 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and G-CSF quantification using a human Bio-plex PRO assay (Biorad) following the manufacturer’s instructions and acquired with the Luminex200 instrument (Luminex).
-
bioRxiv - Immunology 2023Quote: ... A human RPP30 copy number assay labeled with HEX (Bio-Rad, dHsaCP1000485) was used to measure total allelic copy numbers ...
-
bioRxiv - Immunology 2023Quote: ... with human IgA positive and negative controls (Bio-Rad, Cat No. 12014775), Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-rad using the HuCAL technology ...
-
bioRxiv - Bioengineering 2023Quote: We verified the conjugation of peptides to the ICBs following SDS-PAGE under reduced conditions using the Mini-PROTEAN Tetra system (Bio-Rad). The unmodified and peptide-conjugated ICBs were reduced to corresponding heavy and light chains of the Abs by incubating the formulations with 50 mM DTT for 10 min at 70 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Microbiology 2022Quote: ... and Bio-Plex Pro Human Cytokine 27-plex assay (Bio-Rad, California, USA) were used to detect urinary cytokines ...