Labshake search
Citations for Bio-Rad :
251 - 300 of 9525 citations for Formaldehyde Detection Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... on CFX96 TouchTM Real-Time PCR Detection System (BioRad). The genome sequence of P ...
-
bioRxiv - Cancer Biology 2020Quote: ... on the CFX384 RT-PCR detection system (Bio-Rad). Isoform-specific primers sequences and housekeeping gene primers are shown in the Supplement Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and imaged using the detection solution (BioRad, 170-5061) and ChemiDoc imaging system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... The CFX Connect Real-Time PCR Detection System (BioRad) was used to run RTq-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a Real-Time PCR Detection System (Bio-Rad). Bacterial strains were grown for 2 hours at 37°C under inducing conditions in LB ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). The data were analyzed by the comparative threshold method ...
-
bioRxiv - Physiology 2020Quote: ... real-time detection method (BioRad MyIQ RT-PCR, Thermo).
-
ATM-mediated DNA damage response in macrophages primes phagocytosis and immune checkpoint regulationbioRxiv - Immunology 2020Quote: ... on CFX96TM Real-Time PCR Detection System (Bio-Rad). The cDNA was added to qPCR buffer Master-mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... CFX96 Real-Time PCR detection system (Bio-Rad Laboratories), or CFX384 Real-Time PCR detection system (Bio-Rad Laboratories).
-
bioRxiv - Cancer Biology 2021Quote: Detection was performed using the iQ5 QPCR apparatus (Biorad), using IQ green super mix (Biorad) ...
-
bioRxiv - Microbiology 2022Quote: ... in a CFX96 real-time PCR detection system (BioRad). Specific primers were designed using the PrimerQuest tool (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Systems Biology 2022Quote: ... Real-time sequence detection software (Bio-Rad Laboratories; 1845001) was used to compute Cycle threshold (CT) ...
-
bioRxiv - Physiology 2019Quote: ... on a CFX384 Real-Time PCR Detection system (BioRad). 2.8 ng cDNA was added to each well ...
-
bioRxiv - Cancer Biology 2019Quote: ... and CFX96 Real-Time PCR detection system (Bio-Rad). The primers used for real-time PCR were designed based on the Universal Probe Library (Roche ...
-
bioRxiv - Immunology 2019Quote: ... in CFX96 Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... Protein detection was carried out using chemiluminescence (Bio-Rad) and imaged using a ChemiDoc imaging system (Bio-Rad).
-
bioRxiv - Microbiology 2019Quote: ... and visualized using Western Clarity detection reagent (Bio-Rad). Chemiluminescence was detected using a ChemiDoc Imager System (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... on CFX96 real-time PCR detection system (BIO-RAD). QPCR data were analyzed on CFX manager 3.1 (BIO-RAD).
-
bioRxiv - Neuroscience 2021Quote: ... by CFX384 Touch Real-Time PCR detection system (BioRad). Primers were optimized and designed to hybridize with different exons ...
-
bioRxiv - Microbiology 2021Quote: ... a CFX Connect RealTime PCR Detection system (Bio-Rad) or a 7500 Real Time PCR System (Applied Biosystems).
-
bioRxiv - Microbiology 2020Quote: ... was used for detection with ChemiDoc (Bio-Rad, USA).
-
bioRxiv - Biochemistry 2022Quote: ... A CFX384 Touch Real-Time PCR Detection System (BioRad) was used with the following cycling parameters ...
-
bioRxiv - Bioengineering 2022Quote: Real-Time PCR Detection System (Biorad, CFX96 or CFX384)
-
bioRxiv - Molecular Biology 2022Quote: ... using CFX96 Touch Real-Time PCR Detection System (BIORAD) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... using Bio-Rad iQ5 detection instrument (Bio-Rad, USA) under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... and a CFX96 Real-Time Detection System (Bio-Rad). Total 16S rRNA gene quantities were targeted using bacterial-specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... on a CFX96 Real-Time Detection System (Bio-Rad) in reaction volumes of 15 μl under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... and CFX96 Touch Real-Time PCR Detection System (Biorad). The primer set for qPCR is ‘GGGGTGCTATCAGAGGCATC’ and ‘TAGGACCCTTGGTACCGGAG’.
-
bioRxiv - Physiology 2022Quote: ... Detection was performed on a ChemiDoc system (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used and quantification was performed with the DDCt method ...
-
bioRxiv - Cell Biology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Chemiluminescent detection was performed using ECL substrate (BioRad; #1705060).
-
bioRxiv - Cancer Biology 2023Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad). The specific primers for qPCR are listed in Supplemental Table S5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a CFX384 RT-PCR detection system (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... CFX Connect Real-Time PCR detection system (Bio-Rad) was used for measurement and analysis.
-
bioRxiv - Molecular Biology 2023Quote: ... on a CFX384 Real-Time PCR Detection System (BioRad) using the following thermal cycling conditions ...
-
bioRxiv - Genomics 2023Quote: ... and the Immun-Star AP detection system (Bio-Rad). The following antibodies were used for detection ...
-
bioRxiv - Microbiology 2023Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... Bands were visualized by chemiluminescence detection reagents (BioRad, #1705061) and imaged using a FusionFX Chemiluminescence Imager System (Vilber) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with CFX-96 Real-Time PCR Detection System (BioRad). The primers used in this study targeting histone H4C5 are ...
-
bioRxiv - Physiology 2023Quote: ... was used for the detection with ChemiDoc (Bio-Rad). Densitometric analysis of immunoblots was performed using Image Lab software (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... using a chemiluminescence detection reagent (ECL Clarity, Bio-Rad). Primary antibodies used are anti-phosphothreonine polyclonal antibody (9381 ...
-
bioRxiv - Plant Biology 2023Quote: ... The SFX96 TouchTMReal-Time PCR Detection System (Bio-Rad) was used for RT-qPCR performance ...
-
bioRxiv - Cancer Biology 2023Quote: ... An enhanced chemiluminescence detection system (ECL) and Chemidoc (BioRad) were used to develop the signal from HRP-conjugated secondary antibodies.
-
bioRxiv - Cancer Biology 2023Quote: Detection was performed using the iQ5 QPCR apparatus (Biorad), using IQ green super mix (Biorad) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and CFX Real-Time PCR Detection System (Bio-Rad). The data were analyzed by CFX Maestro qPCR Analysis Software (Bio-Rad) ...