Labshake search
Citations for Bio-Rad :
701 - 750 of 9525 citations for Formaldehyde Detection Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... and CFX96 Touch Real-Time PCR Detection System (Bio-Rad, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Immuno-reactive proteins were detected with Clarity One detection reagent (Bio-Rad) and visualized using the ChemiDoc XRS+ System (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, 1855195) with 1 ng cDNA and primers listed in Table S4 ...
-
bioRxiv - Plant Biology 2021Quote: ... on a Bio-Rad CFX384 Touch detection system (Bio-Rad, Philadelphia, USA). Two viral quantification methodologies were employed – one relative and one absolute – using primers and conditions as described by Chinnaraja and Viswanathan125 ...
-
bioRxiv - Neuroscience 2020Quote: ... and detected in a CFX96 thermal cycler and detection system (Bio-Rad). Primers for circadian gene detection are listed below ...
-
bioRxiv - Neuroscience 2020Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 4.
-
bioRxiv - Microbiology 2021Quote: ... in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). The amplicon library was diluted to 7 pM containing 20 % PhiX before sequencing on the MiSeq platform (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... and the CFX Maestro™ Real-Time PCR detection system (Bio-Rad). Dilutions of cDNA template for both standards and all unknowns were run in triplicate with reaction volumes of 10 μl ...
-
bioRxiv - Microbiology 2020Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad), and data were normalized to internal control GAPDH ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was run on CFX Connect Real-Time PCR Detection System (BioRad) using Kapa Probe Fast Universal qPCR Kit (Kapa Biosystems #KK4702) ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed using CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The expression levels were normalized to the internal control actin and GAPDH gene expressions ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantified in a CFX96TM Real-Time PCR Detection System (Bio-Rad). The levels were normalized to the levels of act-1 and/or pmp-3 cDNA.
-
bioRxiv - Cell Biology 2020Quote: ... The polypeptide bands were detected with Gel DocTM chemiluminescence detection system (BioRad) after incubation with SuperSignal™ West Pico Chemiluminescent substrate (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a CFX RT-PCR detection system (Bio-Rad), and relative gene expression was evaluated by SYBR Green (Bio-Rad #1725274 ...
-
bioRxiv - Plant Biology 2022Quote: ... performed on a CFX96 real-time PCR detection system (Bio-Rad Laboratories). The reference gene was selected by comparing the AtUBC9 (ubiquitin conjugating enzyme 9) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Bio-Rad CFX96 touch Real-Time PCR detection system (Bio-Rad). mRNA levels were normalized to their corresponding GAPDH expression levels ...
-
bioRxiv - Neuroscience 2022Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Logarithmic regression was used to plot Ct values against a known number of copies and absolute mtDNA copies number for each sample was calculated as previously described (Gonzalez-Hunt et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... on CFX96 Real-Time PCR Detection System (C1000 Thermal Cycler, Bio-Rad). All primers used in this study are listed in Table EV1.
-
bioRxiv - Microbiology 2022Quote: ... on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, 1855195). Primer sequences can be found in Supplemental Table 1.
-
bioRxiv - Developmental Biology 2022Quote: ... and the iQ™5 Real-Time PCR Detection System from BioRad according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and the CFX96 Touch Real-Time PCR Detection System (Bio-RAD, 1855196). Changes in gene expression levels were determined relative to the housekeeping gene RPLP0 (5′- CTCTGCATTCTCGCTTCCTGGAG -3′ and 5′- CAGATGGATCAGCCAAGAAGG -3′ ...
-
bioRxiv - Neuroscience 2021Quote: ... in CFX384 Touch™ Real-Time PCR Detection Systems (Bio-Rad Laboratories). To normalize the expression data ...
-
bioRxiv - Neuroscience 2020Quote: ... on a CFX96 Real-Time PCR Detection System (Cat# 1855195, Bio-Rad). The following primers were used ...
-
bioRxiv - Neuroscience 2020Quote: RT-PCR was performed using SYBR green detection master mix (BioRad 430001607) and amplification was normalized to expression levels of Gapdh for each sample ...
-
bioRxiv - Neuroscience 2020Quote: ... in a MyiQ Single Color Real-Time PCR Detection System (Bio-Rad), with each reaction performed at a 20 μl sample volume in an iCycler iQ PCR 96-well Plate (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... the polypeptide bands were detected with GelDoc Chemiluminescence Detection System (Bio-Rad). Quantification of relative densitometry was obtained by normalizing to the background and to loading control proteins (ACTB ...
-
bioRxiv - Molecular Biology 2020Quote: qRT-PCR was operated on ABI Prism 7500 Sequence Detection System (BioRad, Life Science Research ...
-
bioRxiv - Immunology 2020Quote: ... The bands were visualized using enhanced chemi-luminescence detection system (Bio-Rad) and quantified using NIH Image J software.
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was conducted using CFX Connect Real-Time PCR Detection System (BioRad). All qPCR data was normalized to GAPDH and RPL13 which are used as housekeepers ...
-
bioRxiv - Cell Biology 2020Quote: ... Bands were visualized using enhanced chemiluminescence detection reagents (Millipore, BioRad, and Ozyme) and autoradiographic films (Blue Devil ...
-
bioRxiv - Biochemistry 2020Quote: ... SYBR green detection qPCR was performed on a CFX384 machine (Bio-Rad). Data was analyzed and converted to relative RNA quantity manually or using CFX manager (Bio-Rad) ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 5 The expression of individual genes is normalized to expression level of Gapdh ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplification was performed using a CFX384 Real-time Detection System (Bio-Rad). Each reaction was performed in technical triplicate ...
-
bioRxiv - Neuroscience 2022Quote: ... and a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Canada). Hippocampal and jejunal samples were analyzed in triplicates ...
-
bioRxiv - Microbiology 2019Quote: ... A CFX Connect Real Time PCR Detection System (Bio-Rad, CA, USA) was used to amplify the DNA templates according to the following program ...
-
bioRxiv - Genetics 2020Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 3.
-
bioRxiv - Microbiology 2019Quote: ... using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Results were analysed using CFX Maestro v4.1.2433.1219 software.
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were developed using an enhanced chemiluminescence detection system from Bio-Rad.
-
bioRxiv - Neuroscience 2019Quote: ... on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA). The primers used are presented as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were run on a CFX384 Real-Time PCR Detection System (BioRad). Met Ct values were normalized to Tfrc using ΔΔCt and compared to normal mouse DNA.
-
bioRxiv - Cell Biology 2020Quote: ... in an iQ cycler and iQ5 Multi-color detection system (Bio-Rad). Primers that were used are indicated in the supplementary Table 2 (primers for actin promoter ...
-
bioRxiv - Plant Biology 2020Quote: ... on CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, USA) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Amplification proceeded using a CFX96 Real-Time PCR Detection System (Bio-Rad) to incorporate a unique sample index/tag sequence and the sequencing adaptors for each sample using the following PCR settings ...
-
bioRxiv - Biochemistry 2020Quote: ... coupled to an iQ5 Multicolor Real-Time PCR Detection System (Bio-RAD). 96 well plates were used with each well containing a total volume of 100 µL consisting of 95% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was realized on CFX96 Touch Real-Time PCR Detection System (Biorad). Analysis of input RNA was performed in the same way on 100 ng of total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was run on CFX96 Touch Real-Time PCR Detection System (BioRad) with the following thermal profile ...
-
bioRxiv - Microbiology 2021Quote: ... A CFX96 Touch Real-Time PCR Detection system (Bio-Rad Laboratories Ltd) was used with the following conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... using the CFX Connect™ Real-Time PCR detection system (BIO-RAD) with gene-specific primers listed in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Shanghai, China) was used under the following conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... and analyzed using CFX connect Real-Time PCR detection system (Bio-Rad). Primers for the qPCR were purchased from Euroventec (table 2).