Labshake search
Citations for Bio-Rad :
251 - 300 of 456 citations for Ferritin light chain FTL Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Images of whole plate phage assay were captured using a ChemiDoc XRS+ imaging system using the epi-light filter (BioRad, USA).
-
bioRxiv - Zoology 2019Quote: ... PCR amplicons were checked by electrophoresis in 3% agarose gels stained with Midori Green (Nippon Genetics) and visualized under UV light using the Chemidoc XRS Chemiluminescent Gel Documentation Cabinet (BIO-RAD). Prior to fragment size analyses ...
-
bioRxiv - Cell Biology 2020Quote: ... Membrane and RNA were cross-linked by exposure to shortwave UV light at 254 nm at 120 mJ (GS Gene linker UV Chamber, BIO-RAD). Membranes were washed in 1× wash buffer (0.1 M maleic acid ...
-
bioRxiv - Bioengineering 2022Quote: ... ethidium bromide at a final concentration of 0.46 μg mL−1 was used and the DNA was visualized under UV light using a GelDoc XR+ system (Bio-Rad).
-
bioRxiv - Plant Biology 2022Quote: ... Infiltrated leaves were infiltrated with 100 µM D-luciferin and LUC activity was quantified after 48 h using a low-light CCD imaging apparatus (Bio-Rad).
-
bioRxiv - Plant Biology 2022Quote: ... 18-5mm Lens) under UV light and leaves were scanned using a laser scanner (Molecular Imager® PharosFX™ Systems, BioRad) at 50µm per pixel ...
-
bioRxiv - Molecular Biology 2023Quote: ... and light units were normalized by the total protein concentrations of the corresponding WCEs determined using the Bradford reagent (BioRad, 5000006).
-
bioRxiv - Plant Biology 2022Quote: ... The quantification of the intensity of the green light signal was performed using the ImageLab software (Bio-Rad, Hercules, California, USA). Therefore ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were run on SDS-PAGE gels (either 4-20% gradient or 17%) and imaged for Alexa647 fluorescence (excitation Red light, emission 700nm +/- 50nm) in a ChemiDoc instrument (Bio-Rad). Proteins were subsequently transferred and blotted ...
-
bioRxiv - Physiology 2022Quote: ... Images were captured for each well in a 24 well plate using a cell imager equipped with the correct LED lights (ZOE, Bio-Rad). Fluorescence intensity was analyzed and quantified using ImageJ software(22 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell death was induced by exposing neurons to UV light (302nm) for 15 min using a Molecular Imager Gel Documentation System XR+ (Bio-Rad). Dead neurons were maintained on ice for 2-3 hours until the time of stereotactic injection into mice ...
-
bioRxiv - Immunology 2023Quote: ... was used for positive signals and the chemiluminescence was detected using a Light Capture AE-6971/2 device (ATTO) or ChemiDoc Touch Imaging System (Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... The blots were then washed three times by PBST and then visualized using an Omni-ECL Femto Light Chemiluminescence Kit (EpiZyme, SQ201) by a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed four times again by PBST and visualized using an Omni-ECL Femto Light Chemiluminescence Kit (EpiZyme, SQ201) through a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Bioengineering 2023Quote: ... base editor cells were kept in the dark for 48 hours after light exposure and fluorescence micrographs were taken on a ZOE Fluorescent Cell Imager (Bio-Rad). To achieve optogenetic base editing of an endogenous gene ...
-
bioRxiv - Microbiology 2024Quote: ... blots were visualized using the LI-COR Odyssey CLx or the Omni-ECL Femto Light Chemiluminescence Kit (EpiZyme, SQ201) and a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Immunology 2020Quote: ... Gene expression was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Hercules, CA, USA) using the gene-specific primers (Table 2 ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Microbiology 2021Quote: ... were treated with 20% blocking buffer (Li-Cor Biosciences, Lincoln, US) followed by incubation with anti-His-tag mouse primary antibody (dilution1/5000, Bio-Rad) and revelation with a IRDye 800CW Goat anti-mouse IgG secondary antibody (dilution 1/10000 ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated with a secondary goat anti-rabbit (for the anti-YjbI antiserum) or goat anti–mouse (for the anti–His-tag antibody) antibody conjugated with horseradish peroxidase (Bio-Rad) for 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... The recovery of tag-less MlaC was quantified using the ratio standard curve method (41) while that of His-tagged nanodisc-embedded complexes were quantified using the Lowry assay (DC Protein Assay, Bio-Rad). For retrograde assay ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Membranes were then washed 3 times with 1X TBST for 10 minutes each before being transferred to a solution containing enhanced chemiluminescence (ECL) substrate to allow visualization of His-tagged sfGFP (Bio-Rad). The blotted proteins were visualized in a ChemiDoc Imaging System (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: Purified recombinant His-tagged proteins were diluted to 0.5µg/ml in either Laemmli sample buffer alone (Bio-Rad, Hercules, CA, USA) or containing 50 mM dithiothreitol (DTT ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Neuroscience 2022Quote: ... the TCE was activated by UV light (300 nm) and the cross-linked proteins were imaged with the ChemiDoc MP Imaging System (Bio-Rad Laboratories) as a loading control (Ladner et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA in agarose gels was stained using ethidium bromide and visualized using ultraviolet light in a BioRad Chemi-doc system with digital camera and Quantity One imaging software (BioRad, Hercules, CA). All gel images were exported from Quantity One as .TIFF images ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Target bands were excised on a blue light transilluminator and purified with a Quantum Prep® Freeze ‘N Squeeze spin column (Bio-Rad). The eluate was further purified with a magnetic bead clean-up (Agencourt® AMPure® XP ...
-
bioRxiv - Microbiology 2024Quote: ... Results with SYBR Green dye were visualized directly either with the naked eyes and or under ultraviolet light and using in gel documentation system (Bio-Rad Gel Doc-XR+, Bio-Rad). In addition ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Genomics 2022Quote: ... was used as a comparison for size estimation and each gel was visualized under UV light on a ChemiDoc XRS+ System (Bio-Rad, CA, USA). The DNA band at 5 to 10kb size was collected for extraction with a NucleoSpin Gel and PCR Clean-up purification kit following the manufacturer’s instructions (Macherey-Nagel ...