Labshake search
Citations for Bio-Rad :
1 - 50 of 1783 citations for Eukaryotic Peptide Chain Release Factor GTP Binding Subunit ERF3A GSPT1 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The antibody and StxB subunits binding capacity per cell of CHO-Lec2 was determined using Quantum (Bio-Rad, Hercules, CA, USA) consisting of five populations of calibration microspheres ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... the light chain by the anti-human kappa light chain antibody (1:2,500; Biorad, cat.no. STAR 127) and GAPDH by the anti-GAPDH monoclonal antibody (1:10,000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody binding was visualized using chemiluminescence (BioRad) on a BioRad ChemiDocTM Imaging System.
-
bioRxiv - Molecular Biology 2023Quote: ... (1990) [71] using the Gene Pulser Xcell Eukaryotic System (BioRad). Once cells were transfected ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants were collected and stored at -80 until α5 subunit and its binding partners were immunoprecipitated using SureBeads protein G magnetic beads according to the manufacturer’s protocol (Biorad, Hercules, CA, USA). Western blots (detailed in section 2.8 ...
-
bioRxiv - Plant Biology 2022Quote: ... Goat anti-mouse Kappa Light Chain antibody (Bio-Rad, #105001G) and Goat Anti-Rabbit (IgG (H + L)-HRP Conjugate #1706515 ...
-
bioRxiv - Plant Biology 2024Quote: ... Goat anti-mouse Kappa Light Chain antibody (Bio-Rad, #105001G) and Goat Anti-Rabbit (IgG (H + L)-HRP Conjugate #1706515 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Prior to electroporation with a Gene Pulser Xcell Eukaryotic System (Bio-Rad), expanded T cells were counted ...
-
bioRxiv - Microbiology 2024Quote: ... and time constant infinity (∞) using Gene Pulser Xcell Eukaryotic System (Biorad, USA). Immediately the contents in the electroporation cuvette were transferred into warm complete culture media (BIS-33 supplemented with 15% adult bovine serum and 2% Diamonds vitamins ...
-
bioRxiv - Neuroscience 2022Quote: ... Antibody binding was detected by chemiluminescence(Clarity kit, Bio-Rad).
-
bioRxiv - Neuroscience 2022Quote: ... Antibody binding was detected by chemiluminescence (Clarity kit, Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibody binding was processed for ECL detection (Bio-Rad) with appropriate HRP-conjugated secondary antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... Antibody binding was visualised using Clarity Western ECL Substrate (Biorad, UK) and viewed under the Gel Doc imaging system (GeneSys software ...
-
bioRxiv - Microbiology 2024Quote: ... Antibody binding was visualised using Clarity Western ECL Substrate (Biorad, UK) and viewed under the Gel Doc imaging system (GeneSys software ...
-
bioRxiv - Systems Biology 2020Quote: ... Unspecific antibody binding was blocked with PBS/10% AB-serum (Bio-Rad) for 5 min at 4°C prior to staining with CD19 or CD3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibody binding was detected using an ECL chemiluminescence kit (Bio-Rad, 1705061). The following antibodies were used ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibody binding was detected using an ECL chemiluminescence kit (Bio-Rad, 1705061). In order to detect multiple proteins for the same set of samples ...
-
bioRxiv - Microbiology 2024Quote: ... The antibody binding was detected using Clarity™ Western ECL substrate (Bio-Rad). Western blot experiments ...
-
bioRxiv - Microbiology 2021Quote: ... The antibody binding was imaged with Clarity Western ECL Substrate (Bio-Rad, CA, USA).
-
bioRxiv - Cell Biology 2024Quote: ... The antibody binding was assessed with a ChemiDoc Imaging System (Bio-Rad, Madrid, Spain) and the density of bands was measured using ImageJ software v.1.8.0_172 (NIH ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cells were electroporated at 320 V and 125 μF using a Gene Pulser XCell Eukaryotic system (Bio-Rad), and resuspended in 1 ml of DMEM supplemented with 10% bovine calf serum ...
-
bioRxiv - Cell Biology 2023Quote: ... the membranes were incubated with goat anti-rabbit IgG (H+L chains) HRP-conjugated secondary antibodies (Bio-Rad) and detected using SuperSignal West Pico ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Binding of VHHs was detected using a mouse anti-HIS-tag antibody (Biorad, MCA1396, 1/2000) and an AF647 conjugated donkey anti mouse IgG antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... antibody binding was detected with either the Clarity or Clarity Max Western ECL substrate (Bio-Rad) and ChemiDoc MP Imaging System (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Binding of the anti-NTD antibody was detected using a goat anti-human kappa light chain conjugated to horseradish peroxidase (HPR) (BioRad). To normalize for the amount of the bound probes ...
-
bioRxiv - Systems Biology 2023Quote: ... and Growth Factor Assay (Biorad) and the Bio- Plex Pro TGFβ Assay (Biorad ...
-
bioRxiv - Cell Biology 2022Quote: ... Square wave electroporation was performed using a Gene Pulser Xcell Eukaryotic System installed with the Capacitance Extender and Pulse Controller modules (BioRad #1652661, BioRad #1652668). Our electroporation protocols were optimized using pulse duration ...
-
bioRxiv - Cell Biology 2022Quote: ... a DNA-binding fluorescent dye (BioRad, SsoAdvanced Universal SYBR Green Supermix ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chain concentration was determined by DC protein assay (Biorad).
-
bioRxiv - Immunology 2020Quote: ... The binding was detected by an HRP-conjugated anti-human IgG (Fc) CH2 Domain antibody (Bio-Rad MCA647P) used at a 1:5,000 dilution at RT for 1 h and developed as described above.
-
bioRxiv - Biochemistry 2024Quote: ... Antibody binding was visualized using Clarity Western ECL Substrate and a ChemiDoc Touch Imaging System (both Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... containing Factor 1 and Factor 2 at manufacturer- recommender concentrations (Bio-Rad, Hercules, CA; cat #171304011). Lung tissues were similarly homogenized in RIPA buffer (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and IgA (heavy chain specific; Bio-Rad, Hercules, CA, USA) secondary antibodies diluted 1:1000 ...
-
bioRxiv - Physiology 2024Quote: ... slides were incubated with primary antibodies for calcitonin gene-related peptide (CGRP, Bio-rad, 1720-9007) and tyrosine hydroxylase (TH ...
-
bioRxiv - Molecular Biology 2020Quote: ... using a DNA-binding fluorescent dye (BioRad, SsoAdvanced Universal SYBR Green Supermix ...
-
bioRxiv - Cell Biology 2022Quote: ... Square wave electroporation was performed using a Gene Pulser Xcell Eukaryotic System installed with the Capacitance Extender and Pulse Controller modules (BioRad #1652661, BioRad #1652668). Our electroporation protocols were optimized using pulse duration ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Eggs were subjected to experimental electroporation parameters (voltage = 50 V; pulse = 25 ms; number of pulses = 1) using the Gene Pulser Xcell Eukaryotic System (Bio-Rad, cat. 1652661). Immediately ...
-
bioRxiv - Pathology 2020Quote: ... Antibody binding was detected with electrochemiluminescence substrate (#12757P; CST) and chemiluminescence visualized with ChemiDoc™MP Gel Imaging System (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... Beads were then transferred to fresh low- protein binding tubes and antibody-protein complexes were eluted by incubating in 60 μL 1x Laemmli Sample Buffer (Biorad, cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... TNFα and RANTES (CCL5) release was assayed by Luminex technology (Bio-Plex 200 from Bio-Rad) with a customized Milliplex kit (Merck Millipore).
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reactions (PCR) were performed using iProof polymerase (Bio-Rad) and primers designed to anneal between 150 and 400 base pairs upstream and downstream of each target gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and mouse anti-rat lambda light chain-HRP (Bio-Rad: MCA2366P), respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... The binding to protein G magnetic beads (Biorad) was performed for 1 hour at 4 ºC (with previous washes with a RIPA buffer) ...
-
bioRxiv - Microbiology 2021Quote: ... the membranes were washed 3 times with 1 x TBS-T and antibody binding was detected in a BioRad Versa Doc System with the Quantity One software (BioRad, Germany) by chemiluminescence using the Clarity Western ECL Substrate (BioRad ...
-
bioRxiv - Biochemistry 2022Quote: Equilibrium target binding assays were performed using a double-membrane filter-binding setup with a slot blot vacuum filtration device (BioRad SF) containing an upper nitrocellulose membrane (to capture protein and protein/RNA complexes ...
-
bioRxiv - Systems Biology 2024Quote: ... Quantitative polymerase chain reaction (qPCR) was performed using a CFX96 (Bio-Rad). Reactions were carried out in a 20 µl mixture of 1 µl diluted cDNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... epidermal growth factor (Serotec/Bio-Rad, EGF-1), hydrocortisone (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... and growth factor biomarkers (Bio-Rad, Hercules, California) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Plates were coated with mouse anti-rat IgM antibody-biotin and detection was carried out by mouse anti-rat kappa/lambda light chain-HRP (Bio-Rad, Hercules, CA, USA: MCA1296P), mouse monoclonal K4F5 anti-rat kappa light chain-HRP (Abcam ...