Labshake search
Citations for Bio-Rad :
101 - 150 of 6703 citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... (see Supplementary Table 3 for a full list of oligos used in the present study) into 384-well hard-shell PCR plates (Bio-Rad HSP3901) using Mantis liquid handler (Formulatrix) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Cancer Biology 2020Quote: ... for smaller pellets 50 µl 1% SDS (Sodium Dodecyl Sulfate, Bio-Rad Laboratories Inc., Hercules, CA, USA) was used.
-
bioRxiv - Cell Biology 2022Quote: ... Equal amounts of denaturated protein in Laemmli buffer were loaded on 12% Sodium dodecyl sulfate gels (BioRad) and blotted on nitrocellulose membranes (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... eluted by boiling in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE) loading buffer (1610737, Bio-Rad), and analyzed by western blotting.
-
bioRxiv - Immunology 2023Quote: ... 10 μg of protein was run on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Bio-rad, 4561034) and transferred to a PVDF membrane (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... and the proteins containing 5× SYPRO™ Orange were loaded onto Hard-Shell® 96-well PCR Plates (Bio-Rad) for measurement ...
-
bioRxiv - Immunology 2023Quote: ... bovis BCG-mCherry) respectively at an interval of 24 hours daily for 5 days using a fluorescence multimode plate reader (Biorad). An MOI of 1 ...
-
bioRxiv - Microbiology 2023Quote: ... and the absorbance was read using an ELISA reader (BIO-RAD) at 450 nm and 570 nm dual filters.
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse primer: 5’-GCAGAAGAAGCAGACACAGC-3’) were PCR amplified and monitored using a CFX96 Touch Real-Time PCR detection system (Bio-Rad). Relative expression of PHETA1 transcripts was normalized to the expression of POLR2A and analyzed using standard delta delta Ct method ...
-
bioRxiv - Microbiology 2020Quote: ... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... were incubated in TBS-T/milk for 45 min and washed 3 × 5 min with TBS-T before detecting using a Chemidoc imager (Bio-Rad). NearIR-conjugated secondary antibodies (LI-COR Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer (HN: 5% Blotting Grade Blocker, Bio-Rad cat ...
-
bioRxiv - Immunology 2022Quote: ... were amplified by PCR using 5’ and 3’ primers with overhangs containing T7 binding sites using iProof High-Fidelity Taq (Bio-Rad). PCR reaction products were run on an agarose gel to check for the correct amplicon ...
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were washed in 1X PBS with 0.1% Tween 3 times for 5 minutes each before scanning using the ChemiDoc™ MP Imaging System (Bio-Rad). Note ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times for 5 min with TBS and were subsequently incubated with Clarity Western ECL substrate working solution (Bio-Rad) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was developed with Clarity Max Western ECL Substrate (Bio-Rad) for 1 minute before imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was developed with Clarity Max Western ECL Substrate (Bio-Rad) for 1 minute before imaging ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The membrane was washed 3 times with TBST for 5 min each and then the membrane was incubated with Clarity Western ECL Substrate (Bio-Rad) for 2 min before exposure to film and development in a darkroom.
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 × 10 min with TBST and exposed with a ECL kit (Bio-rad, cat # 1705061) on X-ray films (Kodak ...
-
bioRxiv - Molecular Biology 2019Quote: ... The reaction components were prepared as a 2x-master mix and 5 µl of the mix was pipetted into opaque wells of 384-well PCR-plate (Bio-Rad). Then an equal volume of sample was added ...
-
bioRxiv - Plant Biology 2020Quote: ... Plates were incubated for 30 °C for 5 or 7 days and imaged using a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Bioengineering 2022Quote: Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) was performed with MiniPROTEAN® Tetra Vertical Electrophoresis Cells (BioRad) using mini-PROTEAN® TGX™ precast gels (BioRad) ...
-
Transient upregulation of translational efficiency in prodromal Tg2576 mice precipitates AD symptomsbioRxiv - Neuroscience 2019Quote: ... Total proteins were separated by 4-15% gradient sodium dodecyl sulfate–polyacrylamide gels (BIO-RAD Laboratories, Hercules, CA) and transferred to nitrocellulose membrane (BIO-RAD Laboratories ...
-
Loss of p32 triggers energy deficiency and impairs goblet cell differentiation in ulcerative colitisbioRxiv - Molecular Biology 2020Quote: ... Protein extracts were separated by denaturing sodium dodecyl sulfate polyacrylamide gel electrophoresis (Bio-Rad Laboratories, Hercules, California, US) under reducing conditions and transferred onto polyvinylidene difluoride membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... Reagents and protein markers used in sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) were obtained from BioRad, India ...
-
bioRxiv - Microbiology 2020Quote: ... This was read at 540 nm on an ELISA reader (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... a sandwich ELISA was performed using a matched antibody pair (BioRad, France) as previously described (Totté et al. ...
-
bioRxiv - Microbiology 2023Quote: ... GM testing with the Platelia enzyme-linked immunosorbent assay (ELISA) (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Membranes were then washed 3 times for 5 min in TBST before detection using Clarity Western ECL Substrate (Bio-rad, 170-5061) and imaging on a ChemiDoc MP (Bio-rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... carried out in glass tubes filled with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (Bio-Rad, USA) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Electrofocusing was performed in glass capillaries with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (#163-1112, #163-1192, Bio-Rad, USA). The second direction is standard SDS 5-10% PAGE followed by staining with Coomassie Brilliant Blue G-250 (#31-4-58-1 ...
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Bioengineering 2021Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 s at 180°C by using a plate sealer (BioRad PX-1; CA, USA) and maintained at 4°C during the LC-MS measurement ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 seconds at 180°C by using a plate sealer (BioRad PX-1; CA, USA) and maintained at 10°C during the LC-MS measurements ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 s at 180 °C using a plate sealer (PX-1; Bio-Rad, Hercules, CA, USA) and maintained at 10 °C during the LC-MS measurements ...