Labshake search
Citations for Bio-Rad :
151 - 200 of 567 citations for Ephrin type A receptor 8 EphA8 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... the sample was applied to a 10 ml ceramic hydroxyapatite Type-II 40 μm (Bio-rad) column (Omnifit ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Microbiology 2021Quote: ... were treated with 20% blocking buffer (Li-Cor Biosciences, Lincoln, US) followed by incubation with anti-His-tag mouse primary antibody (dilution1/5000, Bio-Rad) and revelation with a IRDye 800CW Goat anti-mouse IgG secondary antibody (dilution 1/10000 ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated with a secondary goat anti-rabbit (for the anti-YjbI antiserum) or goat anti–mouse (for the anti–His-tag antibody) antibody conjugated with horseradish peroxidase (Bio-Rad) for 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... The recovery of tag-less MlaC was quantified using the ratio standard curve method (41) while that of His-tagged nanodisc-embedded complexes were quantified using the Lowry assay (DC Protein Assay, Bio-Rad). For retrograde assay ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Membranes were then washed 3 times with 1X TBST for 10 minutes each before being transferred to a solution containing enhanced chemiluminescence (ECL) substrate to allow visualization of His-tagged sfGFP (Bio-Rad). The blotted proteins were visualized in a ChemiDoc Imaging System (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: Purified recombinant His-tagged proteins were diluted to 0.5µg/ml in either Laemmli sample buffer alone (Bio-Rad, Hercules, CA, USA) or containing 50 mM dithiothreitol (DTT ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Developmental Biology 2021Quote: Proteins from each sample were resolved using a precast 8-16% gradient gel (Biorad), and transferred to a PVDF membrane following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Products were detected by running an 8% acrylamide gel (19:1 acrylamide:bisacrylamide) (Bio-Rad), 1X TBE ...
-
bioRxiv - Genomics 2020Quote: Lysates were separated by SDS-PAGE on 3-8% Tris-acetate gels (BioRad #3450129) for 2.5 hours at 150V ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and cryostat sections (8 mm) were stained using rabbit anti-FITC (BioRad; 4510-780) and rat anti-CD31 (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... Bio-Plex Pro Mouse Cytokine 8-plex Assay kit (#M60000007A) (Bio-Rad, Hercules, CA).
-
bioRxiv - Biochemistry 2022Quote: ... The SDS-PAGE gel used weas a pre-cast 8-16 % gradient (Bio-Rad) and initially stained using Pro-Q™ Emerald 300 glycoprotein staining kit to highlight glycoproteins and subsequently stained with coomassie to visualise total protein ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on 8–16% Mini-PROTEAN® TGX Precast gels (Bio-Rad) and transferred onto 0.2 µm nitrocellulose membrane (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... and equal amounts were separated by 4–15% or 8–16% SDS-PAGE (BioRad) and blotted onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2020Quote: ... pH 8) and eluted by boiling the samples for Laemmli sample buffer (Bio-Rad). Eluates were collected from the beads by centrifugation and resolved on a NUPAGE 4-12 % Bis-Tris gel (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... 25ug of sample was loaded per well on 8-12% Bis-Tris gels (BioRad) and run for 2.5h/100V ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on gradient 8-16% Mini-Protean TGX precast gels (Bio-Rad) and transferred onto 0.45 μm pore nitrocellulose ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified whole cell lysates were run on a 8-16% SDS-PAGE gel (BioRad) and transferred to a nitrocellulose membrane (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... samples were run through Criterion XT Tris-acetate precast gels (3-8% gradient) (Biorad) in a XT tricine buffer (Biorad) ...
-
bioRxiv - Immunology 2023Quote: ... The lysates were separated by 8-16% pre-cast SDS-PAGE gels (Bio-Rad) and transferred onto PVDF membranes ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein was separated by 8%–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Bio-Rad) and blotted on polyvinylidene difluoride membrane (Merck Millipore) ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Molecular Biology 2019Quote: ... in Tris-glycine-SDS running buffer or 3-8% Criterion XT Tris-acetate gels (BioRad) in Tris-acetate-SDS running buffer ...
-
bioRxiv - Immunology 2019Quote: ... lysates were resolved using precast Mini-PROTEAN TGX gels 8-16% gradient gels (Bio-Rad) and transferred to nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were separated in 8–12% SDS-PAGE and transferred to a nitrocellulose membrane (BioRad). The membrane was blocked in 5% milk ...
-
bioRxiv - Immunology 2020Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked 10 min with 8% (w/v) non-fat dry milk (Bio-Rad) in Tris-buffered saline (TBS)-T and stained with primary antibodies (listed in material section ...