Labshake search
Citations for Bio-Rad :
51 - 100 of 10000+ citations for Dickkopf related protein 1 DKK 1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... His-tagged proteins in the cleared lysate were purified using Profinity™ IMAC Nickel Charged Resin (Bio-Rad) and eluted in 50 mM sodium phosphate buffer with 300 mM NaCl pH 8 and 300 mM imidazole (Fischer Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were determined using Bradford Assay Kit 1 (Bio-Rad) and 30µg of protein were loaded onto 8% SDS-Page Gels (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Cell Biology 2022Quote: ... along with Rhodamine-conjugated ɑ-GAPDH human Fab fragment (1:1000, Bio-Rad, 12004168). The blots were imaged on the ChemiDoc MP system and quantified using Image Lab software (Bio-Rad).
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Plex Pro Human Inflammation Panel 1 IL-28A / IFN-λ2 (Bio-rad, 171BL022M), Bio-Plex Pro Human Inflammation Panel 1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant contained 2.5 mg proteins/ 1 ml (determined using Bio-Rad Protein Assay, Cat. No. 5000006). This protein fraction was used for co-immunoprecipitation (input) ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-tagged recombinant protein was purified using Ni-NTA purification with the help of Ni-charged resins (Bio-Rad). Purified protein was further used for kinase assay ...
-
bioRxiv - Microbiology 2020Quote: One ug of each respective protein was mixed at a 1:1 ratio with 2X Laemmli buffer (Bio-Rad) which was supplemented with 2% β-mercaptoethanol (Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 mM phenylmethylsulfonyl fluoride (PMSF) and protein concentration was determined using the DC protein assay (Bio-Rad). Whole cell lysates were resolved by SDS-PAGE in 4-20% gradient Mini-PROTEAN TGX gels (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... and the protein concentration was measured using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201) in a Tecan Infinite F200 PRO spectrophotometer ...
-
bioRxiv - Neuroscience 2022Quote: ... Following measurement of the protein concentration using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201) in a Tecan Infinite F200 PRO spectrophotometer ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-Myelin Basic Protein (BIO-RAD, reference MCA409S, 1/1000 dilution), rabbit anti-β-Tubulin III (Tuj1 ...
-
bioRxiv - Biochemistry 2021Quote: Purified proteins concentrated to 1 mL or gel filtration standards (BioRad, 1511901) were injected on to Hi-Load pg200 column and 150 mL eluate was collected as 1.0 mL fractions at 1.0 mL/min. ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were prepared in 1× Laemmli buffer (Bio-Rad, Cat. No. 1610747) supplemented with β-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... 100 µl/ well of protein G-HRP conjugate (1:3000, Bio-Rad) in PBS was added and incubated for 1 hr at 37°C and then washed with PBST ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the Bio-Plex Pro™ Human Inflammation Panel-1 Kit (37-Plex, Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... His6 tagged proteins were detected with anti-His6 primary antibody (Pierce; 1:6,000) and antimouse secondary antibody (Biorad; 1:10,000). GroEL was used as cytoplasmic control and detected as above ...
-
bioRxiv - Microbiology 2022Quote: ... mouse-anti His (BIO-RAD; MCA1396GA), mouse-anti p65 (F-6 ...
-
bioRxiv - Microbiology 2023Quote: ... A mouse anti-His antibody (Biorad) was used as a primary antibody in a 1:500 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration das measured of each eluate sample in a 1:20 dilution by Bradford (BioRad protein assay). Per sample ...
-
bioRxiv - Biochemistry 2022Quote: Proteins were reduced with 1 mM TCEP for 1 h then passed through a 10DG desalting column (Bio-Rad, Hercules, CA) to remove the TCEP ...
-
bioRxiv - Microbiology 2022Quote: ... His6 tagged proteins were detected with anti-His6 primary antibody (Pierce; 1:6,000) and anti-mouse secondary antibody (Biorad; 1:10,000). GroEL was detected with anti-GroEL primary antibody (Pierce ...
-
bioRxiv - Biophysics 2022Quote: ... Both this sample and the total cell protein sample were mixed 1:1 with 2x loading buffer: 50% 4x Laemmli Sample Buffer (Bio-Rad), 30% 100 mM DTT ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 mM sodium vanadate and equilibrated for protein content (Biorad assay kit). All lysates were resolved by SDS-PAGE electrophoresis and transferred to PVDF membranes ...
-
bioRxiv - Immunology 2023Quote: ... the membranes were incubated with protein G-HRP conjugate (1:3000, Bio-Rad) for 1 hr at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The recovery of tag-less MlaC was quantified using the ratio standard curve method (41) while that of His-tagged nanodisc-embedded complexes were quantified using the Lowry assay (DC Protein Assay, Bio-Rad). For retrograde assay ...
-
bioRxiv - Immunology 2023Quote: Purified recombinant His-tagged proteins were diluted to 0.5µg/ml in either Laemmli sample buffer alone (Bio-Rad, Hercules, CA, USA) or containing 50 mM dithiothreitol (DTT ...
-
bioRxiv - Plant Biology 2020Quote: ... Endpoint analysis and allelic discrimination related to SNP calls were accomplished using the CFX96 Touch™software (BioRad, CA, USA). The DNA of the restorer line Primepi was used as a reference control for Rf3 (Geyer et al ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... gossypii proteins) or TBS (S. cerevisiae proteins) supplemented with 1 mM DTT using pre-equilibrated BioSpin-6 spin columns (BioRad) or ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were precleared with control antibody plus 30 µL of 1:1 Protein-A/G magnetic beads (BIO-RAD, Hercules, CA, USA) for 1 h at 40C ...
-
bioRxiv - Cell Biology 2023Quote: 600 μL of DMEM GlutaMax™ supplemented with 10% FBS, 20 μg/mL gentamycin, and either 100 ng/mL recombinant mouse Monocyte chemoattractant protein-1 (MCP-1, CCL2) (Bio-Rad, PMP35) or vehicle control (ddH2O) ...
-
bioRxiv - Microbiology 2024Quote: ... SigA proteins were detected using anti-SigA85 (1:10,000 dilution) combined with anti-rabbit-HRP secondary (Bio-Rad, #1706515, 1:5,000 dilution) antibodies ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... the light chain by the anti-human kappa light chain antibody (1:2,500; Biorad, cat.no. STAR 127) and GAPDH by the anti-GAPDH monoclonal antibody (1:10,000 ...
-
bioRxiv - Immunology 2023Quote: ... or sensitized with 1 mg/mL chimeric human IgE anti-NP antibody (MCA333S, BIO-RAD, Hercules, CA), or in combination for 24 hours ...
-
bioRxiv - Immunology 2024Quote: ... 1:1200 diluted mouse anti-human HLA-E monoclonal primary antibody (clone MEM-E/02, Bio-Rad) and as secondary antibody goat anti-mouse polyclonal antibody conjugated with horse radish peroxidase (HRP ...
-
bioRxiv - Cancer Biology 2024Quote: ... diluted 1:4 and analyzed using Bio-Plex ProTM Human Chemokine Panel 40-plex Assay (Bio-rad). Acquisitions and analyses were performed on a Bio-Plex 200 system with Manager 6.1 Software (Bio-rad) ...
-
Adipocyte vesicles: ‘all-in-one’ packages that stimulate tumor mitochondrial metabolism and dynamicsbioRxiv - Cancer Biology 2019Quote: ... Labeled EV and cells treated or not with these EV were lysed in PBS containing 1% SDS and protein concentration was determined using the DC™ Protein Assay from Biorad. Samples were then processed and analyzed using nano-LC-MS/MS ...
-
Adipocyte vesicles: ‘all-in-one’ packages that stimulate tumor mitochondrial metabolism and dynamicsbioRxiv - Cancer Biology 2019Quote: ... EV were lysed in PBS containing 1% SDS and protein concentration was determined using the DC™ Protein Assay from Biorad. Samples were then processed and analyzed using nano-LC-MS/MS ...
-
Adipocyte vesicles: ‘all-in-one’ packages that stimulate tumor mitochondrial metabolism and dynamicsbioRxiv - Cancer Biology 2019Quote: Cells or EV were lysed in PBS containing 1% SDS and protein concentration was determined using the DC™ Protein Assay from Biorad. 2μg of proteins were electrophoresed on SDS-PAGE ...
-
bioRxiv - Biophysics 2022Quote: ... Resulting membranes were resuspended in 100 μL solubilization buffer (1xPBS, 1% DDM, EDTA-free protease inhibitors) and total protein concentration was quantified using DC protein assay (Bio-Rad). For each condition ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:2000)] proteins were detected using ClarityTM Western ECL Substrate (Bio-Rad. #170-5060). All western blots were repeated at least 3 times.
-
bioRxiv - Cancer Biology 2021Quote: ... 1:2000)] proteins were detected using ClarityTM Western ECL Substrate (Bio-Rad. #170-5060). All western blots were repeated at least 3 times ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was estimated by Quick Start Bradford 1 X Dye reagent (5000205, BioRad) using a microplate reader (EnVision Multilabel Plate Reader ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were mixed 1:4 with 4X Laemmli buffer (Bio-Rad, Lunteren, Netherlands) containing 10% (v/v ...