Labshake search
Citations for Bio-Rad :
1 - 50 of 484 citations for Dengue Virus Serotype 3 VLP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... it was screened for Dengue virus (DENV) using the Dengue NS1 Ag STRIP (Bio-Rad). The use of human blood was approved by the Fiocruz Ethical Committee (CAAE 53419815.9.0000.5248).
-
bioRxiv - Biochemistry 2022Quote: ... The blood was screened for Dengue virus (DENV) using the Dengue NS1 Ag STRIP (Bio-Rad) before use in the mosquitoes feeding process ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Immunology 2023Quote: VLPs were denatured by heating in 2xLaemmli buffer containing 2-mercaptoethanol (Bio-Rad) for 10 minutes at 95°C ...
-
bioRxiv - Immunology 2023Quote: ... VLPs were denatured by heating in 4xLaemmli buffer containing 2-mercaptoethanol (Bio-rad) for 10 minutes at 95°C ...
-
bioRxiv - Immunology 2024Quote: VLPs were denatured by heating in 2xLaemmli buffer containing 2-mercaptoethanol (Bio-Rad) for 10 minutes at 95°C ...
-
bioRxiv - Microbiology 2023Quote: ... NS1 antigen levels were measured using the Platelia™ Dengue NS1 Antigen kit (Cat No. 72830, Bio-Rad, France) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... We determined the serotype of all isolates with specific antiserum (Bio-Rad). Metabolic changes in BES isolates were assessed using procedures detailed in Fig ...
-
bioRxiv - Biophysics 2020Quote: ... 10μl of VLPs or cell extracts were then denatured by Laemmli sample buffer (BioRad, Hercules, CA) with 5% BME and boiled at 95C for 10min ...
-
bioRxiv - Microbiology 2023Quote: ... Total protein concentration of purified DENV VLP was measured by Quick Start Bradford Protein Assay (Bio-Rad). Purity of the DENV VLP was assessed by SDS-PAGE followed by Coomassie dye-based staining using QC colloidal Coomassie stain (Bio-Rad) ...
-
bioRxiv - Systems Biology 2021Quote: Differential expression of ten selected transcripts in response to virus at 3-L1 stage was examined using Droplet Digital PCR (ddPCR) (Bio-Rad, Hercules, CA). Because of the difficulty in obtaining a large amount of gut RNA samples and the limited sensitivity of conventional qPCR technique to detect gene expression at a low level ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Concentration of the VLPs was estimated by Bradford assay and densitometry using SDS PAGE analysis of serially diluted VLP preparations on Mini-PROTEAN Precast Gels (Bio-Rad), stained with GelCode Blue Stain (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... Purity of the DENV VLP was assessed by SDS-PAGE followed by Coomassie dye-based staining using QC colloidal Coomassie stain (Bio-Rad). The morphologies of DENV VLPs were analyzed at the National Institute of Infectious Disease in Japan (NIID ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-canine distemper virus nucleoprotein mouse monoclonal primary antibody (Biorad) in selected fox tissues.
-
bioRxiv - Neuroscience 2024Quote: ... The final virus samples were titered by digital droplet PCR (BioRad) using a REP-specific primer/probe set for libraries and a CMV primer/probe set for recombinant virus (Supplementary Table 2) ...
-
bioRxiv - Genomics 2024Quote: ... The multiple detection of the four known DENV serotypes (DENV-1 to 4) was performed in a CFX Opus Real-Time PCR System (Bio-Rad, Hercules, CA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... Virus was inactivated by adding 50 μl of 2X Laemmli buffer (BioRad) and incubating at 95 °C for 10 minutes.
-
bioRxiv - Microbiology 2021Quote: Virus or pseudovirus concentrates were lysed in 4x Laemmli buffer (Bio-rad) with 10% β-mercaptoethanol and run on SDS-PAGE gels ...
-
bioRxiv - Microbiology 2022Quote: Virus or pseudovirus concentrates were lysed in 4x Laemmli buffer (Bio-rad) with 10% β-mercaptoethanol and run on SDS-PAGE gels ...
-
bioRxiv - Microbiology 2021Quote: Concentrated PV or virus was mixed with 4x Laemmli sample buffer (Bio-Rad) with 10% β-mercaptoethanol and run on SDS-PAGE gels ...
-
bioRxiv - Immunology 2023Quote: ... (ii) genes in RNA virus infection panel of pre-designed human PrimePCR by BioRad; (iii ...
-
bioRxiv - Immunology 2021Quote: ... and TaqMan Fast Virus 1-step Master Mix) using CFX-96 (Bio-Rad, Hercules, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... Concentrated virus was then inactivated and proteins denatured by heating with 4x Laemmli sample buffer (Bio-Rad) with 10% β-mercaptoethanol and subsequently run on a 4-20% Mini-PROTEAN TGX protein gel (Bio-Rad) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: Total viral RNA was extracted from 0.1 ml virus stocks using Aurum Total RNA Mini Kit (Bio-Rad) and eluted in 50 μl elution buffer pre-heated to 70°C ...
-
bioRxiv - Microbiology 2020Quote: Resuspended purified beta-propiolactone treated SARS-CoV-2 virus preps were separated by SDS-PAGE (Bio-Rad TGX Mini) and transferred to 0.2 µM PVDF membrane according to the manufacturer’s protocols (Bio-Rad Tansblot Turbo) ...
-
bioRxiv - Microbiology 2022Quote: ... Virus was then inactivated and whole cell lysates taken by the addition of 2× Laemmli buffer (Bio-Rad #161073) + 2-mercaptoethanol (Bio-Rad #1610710 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: The specific fluorescence produced during the formation of amplicons/ PCR product from the genomic RNA (converted to cDNA) of Rabies virus was identified by the detector in the qPCR machine (CFX CONNECT, BIORAD). The quantitative result is expressed in terms of relative quantification ...
-
bioRxiv - Pathology 2022Quote: ... with an in-house full virus standard for determination of genome loads on a C1000 thermal cycler with the CFX96 Real-Time System (Biorad).
-
bioRxiv - Microbiology 2020Quote: ... One microgram of each concentrated virus preparation was resolved on a 4-20% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, Bio-Rad) and the S-F protein and the NDV hemagglutinin-neuraminidase (HN ...
-
bioRxiv - Microbiology 2022Quote: ... Absolute quantifications of virus RNA copies were estimated by modelling a Poisson distribution using QuantaSoft™ analysis software version 1.7 (Bio-Rad). Mean signal from N1 and N2 was extrapolated and expressed as viral RNA copies per microliter of supernatant ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... Virus quantification of KO/activation pool was done by droplet digital PCR (ddPCR) using QX200 Droplet Digital PCR System (Bio-RAD, #1864001).
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Immunology 2019Quote: ... The calculation of IgG antibody concentration against each individual influenza virus strain rHA was performed by Bio-Plex Manager™ 6.2 software (Bio-Rad Co., CA).
-
bioRxiv - Pathology 2023Quote: Rabies virus N gene was amplified by real-time quantitative PCR using iTaq™ Universal SYBR® Green One-Step Kit (BIO-RAD). The primers are as follow ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RNA copy numbers were determined by ddPCR (see AAV virus quantification) using Taqman primers for the WPRE element (Sup. Table 1) and Rpp30 (Biorad, assay ID: dMmuCPE5097025) as housekeeping gene.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...