Labshake search
Citations for Bio-Rad :
51 - 100 of 9051 citations for Dengue Virus Serotype 3 DIII envelope protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed and blocked in 1x TBST with 5% bovine serum albumin before consecutive incubation with primary antibody (see Suppl. Table 3) and horseradish peroxidase-coupled protein A (Cymed) and detection using Clarity Western ECL Substrate (BioRad).
-
bioRxiv - Neuroscience 2020Quote: ... containing the crude synaptosomes was resuspended and processed for western blotting in NP-40 lysis buffer as above with the following modifications: equal amounts of protein per sample (unboiled) were separated on 3-8% Tris-Acetate XT gel (Bio-Rad) in XT Tricine running buffer (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were checked for purity and presence of protein using 15% SDS-PAGE (Polyacrylamide gel electrophoresis, Mini Protean 3 System, Bio-Rad) and Coomassie Brilliant Blue (Merck ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Immunology 2020Quote: ... 6µg of Round or Rod-shaped CCMVTT-VLPs were mixed with 2x mercaptoethanol and heated at 95°C for 3 minutes and then loaded into Any kD Mini-PROTEAN TGX precast protein gels (BIO-RAD). Gel was run for 35min at 180V ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... The blots were washed 3 times in PBS-T and the proteins were visualized using Clarity Western ECL blotting substrate (Bio-Rad) or SuperSignal West Femto (ThermoScientific) ...
-
bioRxiv - Immunology 2021Quote: ... and TaqMan Fast Virus 1-step Master Mix) using CFX-96 (Bio-Rad, Hercules, CA, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... Band intensities of at least 3 individual experiments were measured densitometrically and normalized to whole protein using the Image Lab Software 5.1 from BioRad (Biorad, Munich, Germany).
-
bioRxiv - Neuroscience 2023Quote: ... Samples were prepared for gel electrophoresis by adding a volume containing 20 ug protein to 3 uL 1 M DTT and 7.5 μL 4X Laemmli sample buffer (BioRad Cat. No. 1610747) and topping up to 30 μL with deionized water ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were washed 3 x 10min in TBS + Tween 20 before proteins were detected by Immuno-Star luminol-peroxide (Bio-Rad, #170-5070). Bio-Rad Chemi-doc was used to visualize and quantify proteins with densitometry.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: Total viral RNA was extracted from 0.1 ml virus stocks using Aurum Total RNA Mini Kit (Bio-Rad) and eluted in 50 μl elution buffer pre-heated to 70°C ...
-
bioRxiv - Genomics 2022Quote: ... denatured proteins and Precision Plus Protein™ Dual Xtra Prestained Protein Standards (Biorad 1610377) were loaded into 16.5% Mini-PROTEAN® Tris-Tricine Gels (Biorad 4563066 ...
-
bioRxiv - Microbiology 2022Quote: ... Total protein was determined in all samples by Protein Assay (Protein Assay II, BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... Protein concentration was estimated by Lowry’s protein assay method (DC™ Protein Assay, BioRad).
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of clarified lysate (3 x 106 parasite equivalents) were resolved by SDS-PAGE (Mini-PROTEAN®TGX protein gel; Bio-Rad, Hercules, California, USA), transferred to PVDF membrane (Immobilon®-FL ...
-
bioRxiv - Microbiology 2020Quote: Resuspended purified beta-propiolactone treated SARS-CoV-2 virus preps were separated by SDS-PAGE (Bio-Rad TGX Mini) and transferred to 0.2 µM PVDF membrane according to the manufacturer’s protocols (Bio-Rad Tansblot Turbo) ...
-
bioRxiv - Microbiology 2022Quote: ... Virus was then inactivated and whole cell lysates taken by the addition of 2× Laemmli buffer (Bio-Rad #161073) + 2-mercaptoethanol (Bio-Rad #1610710 ...
-
bioRxiv - Microbiology 2020Quote: ... Precision Plus Protein Unstained Protein Standards (Bio-Rad) were used as molecular weight markers ...
-
bioRxiv - Microbiology 2022Quote: ... Precision Plus Protein Kaleidoscope Prestained Protein Standard (BioRad) was used as molecular weight standard.
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Plant Biology 2019Quote: ... The protein concentration of the protein extract was then measured by Bradford (BioRad protein assay). The protein extract was diluted 1:5 to avoid interference of buffer components with the Bradford assay ...
-
bioRxiv - Physiology 2022Quote: ... Protein ladder (5 μL of Precision Plus Protein™ All Blue Prestained Protein Standards, BioRad) was added to wells at the left and right of protein samples ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein content was measured using the Lowry protein assay kit (DC Protein Assay; Bio-Rad). Homogenates were sonicated and centrifuged for 15 min at 5000 g ...
-
bioRxiv - Immunology 2023Quote: ... The samples and a protein ladder (a 1:1 mix of All Blue Prestained Protein Standards: Unstained Protein Standards; Precision Plus Protein™, Bio-Rad) were loaded to 4-15% mini-PROTEAN™ TGX Stain-Free™ Protein Gels (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... Volumes containing 10 µg of protein were resolved using SDS-PAGE (NuPAGE 3-12% gels, Life Technologies or 10% acrylamide Tris-Glycine, Bio-Rad for desmin fibrillar aggregates) and transferred to a nitrocellulose membrane (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentration was determined using DC Protein Assay (BioRad) and 20-50 ug of protein per sample was separated on 4–12% Bis-Tris gels using MOPS or MES running buffer (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentration was determined via DC Protein Assay (BioRad). Soluble and insoluble fractions were normalized to the protein concentration of the input fraction ...
-
bioRxiv - Immunology 2021Quote: ... and protein content normalized (DCA protein assay, BIO-RAD). Protein samples were globally reduced by application of 10 mM TCEP (tris(2-carboxyethyl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentrations were determined using DC protein assay (BioRad) and equal concentrations of protein were subjected to SDS-PAGE then transferred to PVDF membranes ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations were determined (Bio-Rad Protein Assay System), and lysates (∼40 μg ...
-
bioRxiv - Microbiology 2021Quote: ... Precision Plus Protein Kaleidoscope pre-stained protein ladder (BioRad) was loaded along with the samples ...
-
bioRxiv - Cell Biology 2021Quote: ... After protein quantification by Bradford protein assay (Bio-Rad), Laemmli sample buffer 4x was added to samples and heated for 3 min at 95°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were measured using Protein assay reagent (Biorad) and equal amount of proteins were loaded into a 6%-15% SDS-polyacrylamide gradient gel and transferred onto nitrocellulose membrane (BioTraceNT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was quantified using DC protein assay (Bio-Rad) and an equal amount of protein are loaded in each SDS-PAGE gel well and ran at 120 V for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein size markers (Bio-Rad precision plus protein standards) was loaded without heating ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were quantified by DC Protein Assay Kit (BioRad). Gel electrophoresis was run in Criterion TGX Stain-Free Gels (BioRad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Protein concentrations were estimated using Protein assay reagent (BioRad) or BCA protein assay (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Protein concentration was determined using DC Protein assay (Biorad). After boiling in 6× loading dye (330 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein was quantified using the DC protein assay (BioRad) and normalized to 1mg/ml total protein ...
-
bioRxiv - Immunology 2020Quote: ... Protein concentrations were measured by DC Protein Assay (BioRad) according to the manufacturers protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentrations were determined by Bradford protein assay (Biorad) and 40μg of total proteins were then loaded onto 4-15% Tris-glycine polyacrylamide gels (Biorad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was determined using DC Protein Assay (BioRad). Biotinylated proteins were purified with streptavidin beads (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein quantification performed using Bradford Protein Assay (Bio-Rad), and 20µg samples were resolved on a 7% SDS-PAGE gels ...
-
bioRxiv - Cell Biology 2023Quote: Protein concentration was determined by DC protein assay (BioRad).