Labshake search
Citations for Bio-Rad :
301 - 350 of 6194 citations for Corticosterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... the plate was transferred to QX200 droplet reader (Bio-Rad). Results were analyzed using the QuantaSoft software (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... In Hard-Shell 96-Well PCR Plates (Bio-Rad HSP9601), qPCR reactions were set up in technical triplicate by combining 9μL qPCR master mix and 1μL of standard-curve or 10-fold-diluted reverse transcription product ...
-
bioRxiv - Biophysics 2023Quote: ... Plates were imaged using ChemiDoc MP Imaging System (Bio-rad).
-
bioRxiv - Biophysics 2023Quote: ... Plates were imaged using ChemiDoc MP Imaging System (Bio-rad).
-
bioRxiv - Cancer Biology 2023Quote: ... and loaded into Multiplate 96-Well PCR Plates (Bio-rad). Data was acquired for 40 cycles on Bio-Rad C1000 ...
-
bioRxiv - Plant Biology 2023Quote: ... Plates were scanned using a densitometer (GS-800, Bio-Rad), and root length measurement was performed with the Simple Neuronal Tracing plugin of ImageJ/Fiji software ...
-
bioRxiv - Immunology 2023Quote: The assay was run in 96-well plates (Bio-Rad) as described previously (41 ...
-
bioRxiv - Genetics 2023Quote: ... Reactions were prepared in 384-well white PCR plates (BioRad), and measurements were performed on a CFX384 Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Genetics 2023Quote: ... Reactions were prepared in 384-well white PCR plates (BioRad), and measurements were performed on a CFX384 Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Genetics 2023Quote: ... Reactions were prepared in 384-well white PCR plates (BioRad), and measurements were performed on a CFX384 Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Biochemistry 2023Quote: ... Plates were fluorescently imaged using a ChemiDoc MP (Bio-Rad). Individual colonies appearing ERAD-L defective were selected and confirmed using flow cytometry before Hrd1 plasmid isolation (Zymoprep Yeast Plasmid Miniprep II ...
-
bioRxiv - Microbiology 2023Quote: ... The plates were imaged using a Chemidoc system (Bio-Rad) and colony forming units (CFUs ...
-
bioRxiv - Molecular Biology 2023Quote: ... mini-PROTEAN® short plates (Bio-Rad, Cat. No. 1653308), and 15-well 1.5mm mini-PROTEAN combs (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were read with a Microplate Absorbance Reader (Bio-Rad). It should be noted that data from tissue collected for different age groups were analyzed separately as cortices were collected at different times leading to variability in measurements between age groups.
-
bioRxiv - Systems Biology 2023Quote: ... Primer plates were sealed with Microplate B seals (Bio-Rad) and PCR was performed using a Bio-Rad C1000 Thermal Cycler with the following program ...
-
bioRxiv - Evolutionary Biology 2024Quote: Agar plates were imaged using Chemidoc imaging system (Bio-Rad) at the colorimetric setting with an exposure of 1 second ...
-
bioRxiv - Microbiology 2024Quote: ... all plates were imaged either using a Chemidoc (Bio-Rad) on the white tray using the Coomassie blue setting or the black tray using the Cy2 (for GFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... in hard-shell 96-well PCR plates (Bio-Rad Laboratories) on a CFX Connect Real Time System (Bio-Rad Laboratories) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read through a microplate reader (Bio-Rad) at λ=590 nm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Membranes were washed 5 time for 5 minutes with PBST and incubated with horseradish peroxidase (HRP) conjugated secondary antibodies (Biorad) for 2 hours at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Cancer Biology 2021Quote: ... dimethyl sulfoxide (DMSO) was added and the absorbance of each well was measured at 490 nm using an ELISA microplate reader (Bio-Rad, Hercules, CA, USA) (33).
-
bioRxiv - Plant Biology 2019Quote: 5 % Mini-PROTEAN TBE precast gels (Bio-Rad) have been pre-electrophoresed in 0.5x TBE buffer for 60 minutes at 70 V ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... loaded onto a 5% polyacrylamideTBE gel (Bio-Rad) that had been pre-run for 15 minutes in TB Buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 5% powdered milk (Bio-Rad 170-6404) resuspended in 1x TBST ...
-
bioRxiv - Genomics 2019Quote: ... Blocked membrane in 5% Blotting-Grade Blocker (BioRad) in TBS-T (50 mM Tris pH 7.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Non-denaturing 5% polyacrylamide 1xTBE Criterion gels (BioRad) were pre-run 30 minutes before loading the reactions.
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...