Labshake search
Citations for Bio-Rad :
101 - 150 of 281 citations for CD3D&CD3E Heterodimer Human HEK293 Fc Flag&Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... the proteins were eluted from the FLAG beads with 60 μL 2x Laemmli buffer (Bio-Rad, 1610747) supplemented with 10 mM DTT and incubated at 95°C for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... The anti-FLAG immunoprecipitates were subjected to gel electrophoresis and visualized by Oriole fluorescent gel staining (BioRad). Specific bands were excised and digested in gels with trypsin ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Biochemistry 2022Quote: ... FLAG elutions were analyzed by SDS-PAGE on 4-20% Mini- PROTEAN TGX Precast Protein Gels (Bio-Rad) without prior heating to preserve the GFP fluorescence ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-FLAG clone 1/27 was coupled to Affi-Gel 10 resin following the manufacturer’s instructions (Bio-Rad). A549 cells were inoculated at an MOI of 0.2 with S009 PB2-FLAG or S009 PB2-627K-FLAG in a 10 cm dish ...
-
bioRxiv - Biochemistry 2023Quote: ... Clear lysate was passed onto M1-FLAG resin pre-packed into glass Econo columns (Biorad, Cat. no. 7372512) and allowed to gravity-flow at 1-2mL min-1 ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Microbiology 2022Quote: ... the samples were washed extensively with lysis buffer and the proteins were eluted by boiling 5 ul of the resin with 5x SDS loading buffer and the proteins were detected by western blot analysis using rabbit antibody to FLAG (1:2,000, BioRad) or mouse antibody to Myc (1:2000 ...
-
bioRxiv - Cell Biology 2024Quote: Anti-Flag antibody precipitated proteins in the concentrated eluate were resolved in a 4-15% Criterion TGX gel (BioRad) and stained by Colloidal Blue dye (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Microbiology 2020Quote: ... After loading the lysate into the packed volume of 100 µL of FLAG agarose on a gravity column (Bio-Rad) and reloading the flow through twice ...
-
bioRxiv - Biochemistry 2021Quote: ... Ni-NTA and FLAG elutions were analyzed by SDS-PAGE on AnykD Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad). The samples were not heated before loading to preserve the fluorescence of the GFP and mCherry tags ...
-
bioRxiv - Immunology 2024Quote: ... rabbit anti-FLAG-HRP (clone D6W5B, CellSignalingTechnology #86861S, RRID:AB_2800094) or anti-Strep (clone Strep-tag II StrepMAB-Classic, Biorad #MCA2489P, RRID:AB_609796) detection Abs were added for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Immunology 2020Quote: ... and incubated with either FITC-conjugated Sheep Anti-Human C3 (BioRad AHP031F) at 1:500 or AF488-conjugated Mouse Anti-C5b-9 (ae11 ...
-
Antiviral roles of interferon regulatory factor (IRF)-1, 3 and 7 against human coronavirus infectionbioRxiv - Microbiology 2022Quote: ... human IFN-γ and IFN-λ 1 were obtained from Bio-Rad, BD Pharmingen and R&D Systems respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... and G-CSF quantification using a human Bio-plex PRO assay (Biorad) following the manufacturer’s instructions and acquired with the Luminex200 instrument (Luminex).
-
bioRxiv - Immunology 2023Quote: ... A human RPP30 copy number assay labeled with HEX (Bio-Rad, dHsaCP1000485) was used to measure total allelic copy numbers ...
-
bioRxiv - Immunology 2023Quote: ... with human IgA positive and negative controls (Bio-Rad, Cat No. 12014775), Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-rad using the HuCAL technology ...
-
bioRxiv - Molecular Biology 2019Quote: ... Membranes were incubated with HRP-conjugated secondary antibodies for both FLAG and GFP stainings (Rabbit anti-goat-HRP conjugate, #1721034, Bio-Rad) diluted at 1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-FLAG (Cell Signalling Technologies, 2908S), anti-SARS-CoV-2-ORF8 (MRCPPU, University of Dundee, DA088, [37]) and anti-Tubulin (BioRad, MCA77G). Donkey anti-rabbit IRDye 800 and goat anti-rat IRDye 680 (Li-cor Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... membranes were subject to sequential incubation with anti-FLAG mouse antibody (1: 2000 dilution) and secondary anti-mouse IgG conjugated to HRP (Bio-Rad). After washing three times with TBST buffer ...
-
bioRxiv - Microbiology 2020Quote: 100 µL of well mixed anti-FLAG M2 Affinity Gel aliquots were loaded on columns (Micro Bio-Spin Columns, Bio-Rad) and washed two times with 1 mL of cell lysis buffer by gravity flow ...
-
bioRxiv - Immunology 2022Quote: ... prior to overnight incubation in the same buffer with 1:2000 anti-FLAG-HRP (clone D6W5B, CellSignallingTechnology #86861S) or anti-Strep (clone Strep-tag II StrepMAB-Classic, Biorad #MCA2489P) or goat anti-mouse Igκ-HRP (SouthernBiotech #1050-05) ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...