Labshake search
Citations for Bio-Rad :
1 - 50 of 2008 citations for CD366 Tim 3 Antibody APC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were incubated with APC (Lynx Rapid APC antibody conjugation kit, Cat # LNK031APC, Bio-Rad Laboratories, Inc.)-conjugated cytokeratin 6 (CK6 ...
-
bioRxiv - Bioengineering 2023Quote: ... APC anti-CD90 (#MCA90APC, Bio-Rad), PerCP/Cy5 anti-CD105 (#323216 ...
-
bioRxiv - Bioengineering 2023Quote: ... APC anti-CD90 (MCA90APC, Bio-Rad), and PerCP/Cy5 anti-CD105 (323216 ...
-
bioRxiv - Immunology 2022Quote: ... Permeabilised cells were immediately labelled by incubation with anti-bovine IFN-γ-APC mAb (CC302; Bio-Rad Antibodies) diluted in BD PermWash solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... APC anti-mouse F4/80 (MCA497APC, Biorad), PE anti-mouse CD11b (RM2804 ...
-
bioRxiv - Microbiology 2020Quote: ... Excess antibody was washed away with 3 x TBST rinses before the membrane was incubated with anti-mouse secondary antibody (Bio-rad) conjugated to horseradish peroxidase at a 1:15000 dilution in TBST at 25°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies (Table 3) were diluted in 5% non-fat blocking milk (BioRad, Cressier, Switzerland) in TBST and incubated over night at 4°C with mild agitation ...
-
bioRxiv - Cell Biology 2024Quote: ... Membrane was washed 3 times and incubated with secondary peroxidase antibodies (1:1000, Bio-RAD) 1 hour in TBS-Tween 1% ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected with 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad). The CA levels from cells were normalized relative to GAPDH levels ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 3 times in TBSt and then incubated with HRP secondary antibodies (anti-Mouse HRP, Biorad, 170-6516 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed and blocked in 1x TBST with 5% bovine serum albumin before consecutive incubation with primary antibody (see Suppl. Table 3) and horseradish peroxidase-coupled protein A (Cymed) and detection using Clarity Western ECL Substrate (BioRad).
-
bioRxiv - Neuroscience 2024Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; 170-6516, Bio-Rad) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... The blots were washed again after secondary antibody incubation and developed using either nitroblue tetrazolium (NBT)–5-bromo-4-chloro-3-indolylphosphate (BCIP) for AP-conjugated secondary antibodies or the ECL substrate (BioRad) for the HRP labelled secondary antibody after incubating for about 10 to 15 mins at room temperature with gentle shaking ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were washed with TBS-T (3 x 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed with TBST 3 times for 5 minutes each before applying secondary fluorescent antibody (1:2,500, StarBright Blue 520 Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... overnight at 4°C washed in TBST (3×10 min at RT) and then probed with the corresponding peroxidase-conjugated secondary antibody (Biorad) for 1h at RT ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed a further 3 times in TBS-T and bound antibodies were visualised using the Clarity Western ECL substrate (BioRad; #1705061) with a ChemiDoc MP system (BioRad) ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the membrane was blotted with the Chk1-pS345 antibody at the 1:3000 dilution for 3 h to detect the phosphorylated Chk1-Ser345 in ChemiDoc (Bio-Rad). The membrane was stripped ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The membranes were then washed with TBST again 3 times for 15 min before adding Goat Anti-Mouse IgG (H + L)-HRP antibody (1706516, Bio-Rad) 1:10000 in blocking buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were rinsed 3×10 minutes in TBST 0.1% then incubated with appropriate secondary antibody coupled to the horseradish peroxidase (Biorad, 1706515, 1706516; 1/5000) for 1 hour at room temperature under agitation ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was washed 3 times prior to adding 50 μl of 1:1000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Bio-Rad, Cat# 172-1011) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...