Labshake search
Citations for Bio-Rad :
51 - 100 of 1634 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... in 0.2 ml 8-Tube PCR Strips (Bio-Rad™, clear #TBS0201) with 0.2 ml Flat PCR Tube 8-Cap Strips (Bio-Rad™ ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 and 8 using a BioRad TC10 Automated cell counter (BioRad Laboratories, Inc). Growth curves were conducted 5-times ...
-
bioRxiv - Plant Biology 2019Quote: ... The proteins were resolved on 8 or 10% SDS-PAGE (1610156, Bio-Rad) and transferred using the wet transfer method onto a nitrocellulose membrane (10600001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Cell Signaling Akt Panel 8-plex (BioRad, USA; LQ00006JK0K0RR) were used for phosphorylated protein quantification and Bio-Plex Pro Total Akt (BioRad ...
-
bioRxiv - Synthetic Biology 2021Quote: All SDS-PAGE gels contained 8% acrylamide bis-tris (Bio-Rad, pH 6.5). Samples were boiled in 1× Laemmli sample buffer at 90°C for 5 mins before loading to the gels ...
-
bioRxiv - Genomics 2019Quote: ... LIPC_F and LIPC_R (Supplemental Table 8)] by qPCR using SsoFast EvaGreen Supermix (BioRad), according to manufacturer’s protocol.
-
bioRxiv - Biophysics 2020Quote: Polyacrylamide (PAA) substrates were prepared by mixing 8% acrylamide (Bio-Rad, Hercules, CA), 0.1% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... or 0.2 mL white 8-tube PCR strips and optical caps (Bio-Rad). For bacterial cultures ...
-
bioRxiv - Pathology 2023Quote: ... 8 ng of cDNA was used for the SYBR green reagent (BioRad 1725270) reaction for qPCR analysis (BioRad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteins were separated using a 8-16% Mini-PROTEAN Precast Protein gels (BioRad) and transferred to Immobilon-P PVDF membrane (Millipore) ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... avara pased the quality checks (i.e., RIN > 8 in Experion, Bio-Rad, USA). In short ...
-
bioRxiv - Cancer Biology 2024Quote: SDS-PAGE Gels (8% or 10%) were transferred to nitrocellulose membranes (Bio-Rad) using a Trans-blot apparatus (2.5 A constant ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Developmental Biology 2021Quote: Proteins from each sample were resolved using a precast 8-16% gradient gel (Biorad), and transferred to a PVDF membrane following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Products were detected by running an 8% acrylamide gel (19:1 acrylamide:bisacrylamide) (Bio-Rad), 1X TBE ...
-
bioRxiv - Genomics 2020Quote: Lysates were separated by SDS-PAGE on 3-8% Tris-acetate gels (BioRad #3450129) for 2.5 hours at 150V ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and cryostat sections (8 mm) were stained using rabbit anti-FITC (BioRad; 4510-780) and rat anti-CD31 (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... Bio-Plex Pro Mouse Cytokine 8-plex Assay kit (#M60000007A) (Bio-Rad, Hercules, CA).
-
bioRxiv - Biochemistry 2022Quote: ... The SDS-PAGE gel used weas a pre-cast 8-16 % gradient (Bio-Rad) and initially stained using Pro-Q™ Emerald 300 glycoprotein staining kit to highlight glycoproteins and subsequently stained with coomassie to visualise total protein ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on 8–16% Mini-PROTEAN® TGX Precast gels (Bio-Rad) and transferred onto 0.2 µm nitrocellulose membrane (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... and equal amounts were separated by 4–15% or 8–16% SDS-PAGE (BioRad) and blotted onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2020Quote: ... pH 8) and eluted by boiling the samples for Laemmli sample buffer (Bio-Rad). Eluates were collected from the beads by centrifugation and resolved on a NUPAGE 4-12 % Bis-Tris gel (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... 25ug of sample was loaded per well on 8-12% Bis-Tris gels (BioRad) and run for 2.5h/100V ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on gradient 8-16% Mini-Protean TGX precast gels (Bio-Rad) and transferred onto 0.45 μm pore nitrocellulose ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified whole cell lysates were run on a 8-16% SDS-PAGE gel (BioRad) and transferred to a nitrocellulose membrane (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... samples were run through Criterion XT Tris-acetate precast gels (3-8% gradient) (Biorad) in a XT tricine buffer (Biorad) ...
-
bioRxiv - Immunology 2023Quote: ... The lysates were separated by 8-16% pre-cast SDS-PAGE gels (Bio-Rad) and transferred onto PVDF membranes ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein was separated by 8%–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Bio-Rad) and blotted on polyvinylidene difluoride membrane (Merck Millipore) ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Molecular Biology 2019Quote: ... in Tris-glycine-SDS running buffer or 3-8% Criterion XT Tris-acetate gels (BioRad) in Tris-acetate-SDS running buffer ...
-
bioRxiv - Immunology 2019Quote: ... lysates were resolved using precast Mini-PROTEAN TGX gels 8-16% gradient gels (Bio-Rad) and transferred to nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were separated in 8–12% SDS-PAGE and transferred to a nitrocellulose membrane (BioRad). The membrane was blocked in 5% milk ...
-
bioRxiv - Immunology 2020Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked 10 min with 8% (w/v) non-fat dry milk (Bio-Rad) in Tris-buffered saline (TBS)-T and stained with primary antibodies (listed in material section ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The cultures were dispensed in 100 μL aliquots into 8-well PCR strips (Bio-Rad) and incubated for 24 h in a thermal gradient using a DNA Engine Tetrad 2 Peltier Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... 20μg protein was isolated on 8-10% SDS-PAGE and transferred to nitrocellulose membrane (BioRAD). Nonspecific binding was blocked by incubation of membranes with 10% (W/V ...
-
bioRxiv - Molecular Biology 2023Quote: ... The products were analyzed by 8% acrylamide/bis-acrylamide (19:1 ratio, Bio-Rad, 1610145) gel containing 1x TBE and 7M Urea ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 0.2 ml Flat PCR Tube 8-Cap Strips (Bio-Rad™, optical, ultraclear, #TCS0803). Optimum amplification conditions were determined for each by amplifying six concentrations of a 5× dilution series of MG1655 pJK14-Tn4rev pZA31-mCherry-tnpB using two-step amplification with a thermal gradient of 55–75°C ...
-
bioRxiv - Microbiology 2023Quote: ... 40 µg of proteins were loaded onto 3–8% precast polyacrylamide gel (Bio-Rad, 3450129). After migration ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CD8 (2 µg/rat dissolved in saline solution, clone OX-8, Bio-Rad #MCA48G) or anti-rat TCRαβ antibody (2 µg/rat dissolved in saline solution ...