Labshake search
Citations for Bio-Rad :
101 - 150 of 4753 citations for 8 9 Didehydro 3'N demethyl 9 deoxo 4'' 6 12 trideoxy 6 9 epoxy 3'N ethylerythromycin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Biophysics 2021Quote: ... Micro Bio-Spin 6 Columns (molecular weight cutoff 6 kDa; Bio-Rad) were used at 1,000 × g and 4 °C to exchange purified protein samples to 250 mM ammonium acetate (99.99 % purity ...
-
bioRxiv - Developmental Biology 2023Quote: ... Following separation via SDS-PAGE (12%, Mini PROTEAN 3 System, Bio-Rad, Hercules, CA), proteins were transferred to PVDF membrane for 1hr using a Genie electroblot chamber (Idea Scientific ...
-
bioRxiv - Genomics 2020Quote: Lysates were separated by SDS-PAGE on 3-8% Tris-acetate gels (BioRad #3450129) for 2.5 hours at 150V ...
-
bioRxiv - Microbiology 2023Quote: ... samples were run through Criterion XT Tris-acetate precast gels (3-8% gradient) (Biorad) in a XT tricine buffer (Biorad) ...
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... Nuclei were counted on an automated cell counter (TC20 BioRad, range 4-6 um) and further confirmed intact under microscope ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were counted on an automated cell counter (TC20 BioRad, range 4-6 um) and further confirmed intact under microscope ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons at DIV 4-6 were transfected using a biolistic gene gun (Bio-Rad) and were assayed 3 days after transfection as described previously (5,6,26,27) ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Biophysics 2023Quote: ... extracted agarose gel parts were divided by cutting several times and purified via Freeze N′ Squeeze columns (Freeze N′ Squeeze, 7326165, BioRad) according to the manufacturer’s instructions using a benchtop centrifuge (Biofuge fresco ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was extracted from cardiac cultures after 4 days on either soft or stiff PDMS (n=4) using the AurumTM Total RNA Mini Kit (Bio-Rad Laboratories). Libraries were constructed by the Purdue Genomics Core Facilities according to standard protocols using TruSeq Stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Biophysics 2019Quote: ... N-methylene-bis-acrylamide (Bio-Rad, Herculers, USA) are added ...
-
bioRxiv - Immunology 2019Quote: ... Rosa26LSL-tdTomato/+ animals (6-12 weeks) were given 1 μg of FITC-conjugated rat anti-CD169 antibody (BioRad) diluted in a total volume of 20 μl of PBS into the right footpad to label CD169+ subscapular macrophages inside the draining LN ...
-
bioRxiv - Microbiology 2023Quote: ... separated on 6% acrylamide 8 M urea gels and transferred to Zeta Probe GT membranes (Bio-Rad laboratories) by electroblotting ...
-
bioRxiv - Molecular Biology 2019Quote: ... in Tris-glycine-SDS running buffer or 3-8% Criterion XT Tris-acetate gels (BioRad) in Tris-acetate-SDS running buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 40 µg of proteins were loaded onto 3–8% precast polyacrylamide gel (Bio-Rad, 3450129). After migration ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 5.3 (murine P-domains) or pH 7.3 (GII.4 Saga P-domain) at 4 °C via Micro Bio-Spin 6 columns (Bio-Rad) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Bioengineering 2019Quote: ... by means of O/N wet transfer (Bio-Rad) 4 °C at 30 V ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg of ΔORF3-E mNG RNA and 20 μg of N-gene RNA were electroporated into 8×106 Vero-ORF3-E cells using the Gene Pulser XCell electroporation system (Bio-Rad, Hercules, CA) at a setting of 270V and 950 μF with a single pulse ...
-
bioRxiv - Neuroscience 2020Quote: ... SDS-gels (3% stacking gel, 12% separation gel) were run in a Mini PROTEAN® System (BioRad) at 100 V for 10 min and 200 V till end of the separation ...
-
Negative curvature-promoting lipids instruct nuclear ingression of low autophagic potential vacuolesbioRxiv - Cell Biology 2021Quote: ... 10–15 μL of this supernatant was loaded onto a commercial 3–8% acrylamide gradient gel (BioRad) and migrated 70 min at 150 V in 1x Tris-Acetate buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 10–15 µL of this supernatant was loaded onto a commercial 3–8% acrylamide gradient gel (BioRad) and migrated 70 min at 150 V to separate Rad53 isoforms ...
-
bioRxiv - Biochemistry 2024Quote: ... The eluate was analysed by SDS-PAGE using 3-8% Criterion XT Tris-Acetate gels (Bio-Rad) and XT Tricine running buffer (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... anti-Metapneumovirus N mouse monoclonal (1:25) (MCA4674, Bio-Rad), or anti-Influenza A nucleoprotein (NP ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples (20 µg/lane) were electrophoresed on a 6–12% SDS polyacrylamide gel in a Mini-PROTEAN Tetra Cell (Bio-Rad) and subsequently transferred to a nitrocellulose membrane (Sartorius AG ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... antigen retrieval was performed in trypsin (pH 7.8) or 10 mM sodium citrate buffer (pH 6) and then incubated with F4/80 antibody (1:50; MCA497, Bio-Rad) or UCP-1 antibody (1:500 ...
-
bioRxiv - Biophysics 2021Quote: ... beads were washed with wash buffer 6-8 times in poly-prep chromatography columns (cat. no. 7311550, BIO-RAD laboratories Inc). Protein was eluted using Ni-NTA elution buffer (50□mM NaPi pH 7.6 ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second serum panel (n=29 ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 29 sera collected from individuals 1 month after BA.5-bivalent-booster of Pfizer or Moderna vaccine ...
-
bioRxiv - Microbiology 2023Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 20 sera from individuals who were previously infected by SARS-CoV-2 vaccinated with 2-4 doses of parental mRNA vaccine ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant from two reactions were collected and separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Plant Biology 2021Quote: ... At least 4-6 technical replicate RT-qPCR reactions were performed using iTAQ with ROX and SYBR (BioRad), and 20μL reactions were prepared as per the manufacturer recommendations ...
-
bioRxiv - Biochemistry 2020Quote: ... Purification of the desalted bacteriocin protein was performed using an Uno S-6 prepacked monolith cation exchange column (12×55 mm, Bio-Rad, USA) on a FPLC system (BioLogic DuoFlow System ...
-
bioRxiv - Biochemistry 2020Quote: ... the desalted protein fraction was purified using the Uno S6 prepacked monolith cation exchange column (12 × 53 mm, 6 mL, Bio-Rad, USA). The eluted fraction containing purified bacteriocin was concentrated to 4.6 mg/mL in an Amicon centrifugal filter concentrator with a 3 kDa cutoff membrane (Millipore ...