Labshake search
Citations for Bio-Rad :
201 - 250 of 9245 citations for 8 11 Methano 10a 3 6a 1 propanyl 3 ylidene 8H indeno 2 1 b azocine 12 14 dione 5 acetyloxy 4 benzoyloxy dodecahydro 1 3 dimethyl 9 methylene 3R 4S 5R 6aR 6bR 8S 10aR 11R 11aS 15S 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... NS5B-FAM probe: 5’-ATGGGTTCGCATGGTCCTAATGACACAC-3’) and the GAPDH loading control (PrimePCR Probe assay with HEX probe, Bio-Rad). Each 20 μL reaction contained 500 ng of total RNA ...
-
bioRxiv - Biophysics 2024Quote: ... Blots were washed 3 times with TBST for 5 min and visualized using a ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Molecular Biology 2019Quote: ... Denatured protein extracts were resolved using 4-9% SDS-PAGE (4–15% Mini-PROTEAN® TGX™ Precast Protein Gelscat# 4561083, Biorad) and then transferred to a nitrocellulose membrane.
-
bioRxiv - Immunology 2022Quote: ... cell debris was removed by centrifugation and clear supernatants were diluted 10-fold and subjected to anion exchange chromatography on gravity fed columns using AG-1 9 8 resin (formate form, 100–200 mesh size, Bio-Rad Laboratories, Hercules, CA). Fractions containing inositol mono ...
-
bioRxiv - Physiology 2023Quote: ... Samples were run 16 h at 9 °C at 4 V with a 1–10 running ratio in TBE buffer using CHEF-DRII system (Bio-Rad). After the run ...
-
bioRxiv - Pathology 2022Quote: ... The soluble protein extracts were separated by SDS-PAGE (4-15% mini-protein TGX precast gel, 12 or 15 well, BioRad) and transferred to a PVDF membrane (Trans-blot Turbo mini-Format 0.2 μM PVDF ...
-
bioRxiv - Microbiology 2023Quote: ... for the selected clinical isolates using the indicated concentrations of antibiotics via an alamar blue reduction assay completed as described but without shaking.8 After 3 days of incubation with the alamar blue reagent (BioRad, Hercules, CA, USA), the MIC was identified as the lowest concentration of drug that inhibited the reagent color change as determined visually.
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Cell Biology 2024Quote: ... with DTT and resolved on 4-15% 4-20% or 12% Mini-PROTEAN® TGX™ Precast Gels (Biorad) run in Tris/Glycine/SDS running buffer (Biorad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Table 1) was performed at 4°C overnight at a 1:1000 dilution in 5% nonfat dry milk (Bio-Rad No. 1706404). Incubation of HRP conjugated secondary antibody (different species ...
-
bioRxiv - Cancer Biology 2020Quote: ... incubated with 3% H2O2 for 15 min at room temperature and then incubated with goat anti-rabbit IgG-HRP (Bio-Rad 170-6515) secondary antibody diluted 1:300 in the blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were blocked with 3% nonfat dry milk (BioRad 1706404) in 1X PBST for 30 min at room temperature and incubated with the GAPDH antibody (Cell Signaling Technology 2118 ...
-
bioRxiv - Microbiology 2019Quote: ... After washing the plate 3× (MAG3× setting on BioRad wash station) with wash buffer (PBS with 0.05% Tween20) ...
-
bioRxiv - Cell Biology 2022Quote: ... at 400 mA for 3 hours using a MiniTransblot Module (BioRad). After protein transfer ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were sonicated and heated at 95°C for 5 minutes before their separation on a 4-15% gradient SDS PAGE gel (Biorad, 4-15%). Proteins were transferred from gel to nitrocellulose membrane using semi-dry method ...
-
bioRxiv - Microbiology 2022Quote: ... and 1’,3’-bis[1-palmitoyl-2-oleoyl-sn-glycero-3-phospho]-glycerol (16:0-18:1 Cardiolipin) were spotted using a Hamilton syringe onto a nitrocellulose membrane (Biorad trans-blot turbo RTA Midi 0.2 µm) to yield 10 ...
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: Frozen muscle biopsies were homogenised in modified Laemmli sample buffer as described previously.37 Samples were run in Bio-Rad Criterion 3–8 % tris-acetate gradient gels (Bio-Rad Laboratories, CA, USA) at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 µg of total protein per sample was loaded on NuPage 4-12% Bis-Tris Protein gels (Thermo Fischer Scientific) or 4–15% Mini-PROTEAN TGX StainFree Protein gels (Biorad) and run at 200 V as per manufacturer’s instructions ...
-
The Arabidopsis F-box protein FBW2 degrades AGO1 to avoid spurious loading of illegitimate small RNAbioRxiv - Cell Biology 2021Quote: ... either on 7-12% Tris-glycine gels or gradient NuPAGE 4-12% Bis-Tris Protein Gels (Thermo Fischer) or gradient Criterion TGX gel (4-15%) (BioRad). List of antibodies and their working dilution used in this work are reported in (Table S4) ...
-
bioRxiv - Plant Biology 2023Quote: ... either on 7–12% Tris-glycine gels or gradient NuPAGE 4–12% Bis-Tris Protein Gels (Thermo Fischer) or gradient Criterion TGX gel (4–15%) (BioRad). A list of antibodies and their working dilution used in this work are reported in (Table S3) ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Bioengineering 2021Quote: ... A sample containing 1-20µg of protein was loaded into a 4-15% precast gel (Bio-Rad Mini-ProTEAN) and run at 60V for 20min followed by 160V for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins in the extracts were resolved by SDS-PAGE using 12% or 4-15% gradient (BioRad) acrylamide gels ...
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse primer: 5’-GCAGAAGAAGCAGACACAGC-3’) were PCR amplified and monitored using a CFX96 Touch Real-Time PCR detection system (Bio-Rad). Relative expression of PHETA1 transcripts was normalized to the expression of POLR2A and analyzed using standard delta delta Ct method ...
-
bioRxiv - Microbiology 2020Quote: ... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Cell Biology 2021Quote: ... were incubated in TBS-T/milk for 45 min and washed 3 × 5 min with TBS-T before detecting using a Chemidoc imager (Bio-Rad). NearIR-conjugated secondary antibodies (LI-COR Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... were amplified by PCR using 5’ and 3’ primers with overhangs containing T7 binding sites using iProof High-Fidelity Taq (Bio-Rad). PCR reaction products were run on an agarose gel to check for the correct amplicon ...
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were washed in 1X PBS with 0.1% Tween 3 times for 5 minutes each before scanning using the ChemiDoc™ MP Imaging System (Bio-Rad). Note ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times for 5 min with TBS and were subsequently incubated with Clarity Western ECL substrate working solution (Bio-Rad) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was developed with Clarity Max Western ECL Substrate (Bio-Rad) for 1 minute before imaging ...