Labshake search
Citations for Bio-Rad :
101 - 150 of 2701 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA libraries were amplified using 8 PCR amplification cycles (C1000, Bio-Rad). Cluster generation and sequencing was performed using the standard Illumina protocols for Illumina HiSeq 4000 by the University of Chicago Functional Genomics Core facility ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 8 minutes and images were acquired using a ChemiDoc (BIO-RAD). After removal of the Ponceau by washing once with TBS-T (TBS 1X ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracts were resolved on 8% (v/w) SDS-PAGE (1610156, Bio-Rad) and transferred onto a nitrocellulose membrane (0600001 ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Synthetic Biology 2023Quote: ... in 0.2 ml 8-Tube PCR Strips (Bio-Rad™, clear #TBS0201) with 0.2 ml Flat PCR Tube 8-Cap Strips (Bio-Rad™ ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Biochemistry 2020Quote: ... were incubated together at RT for 5 min in the presence and absence of 5 mM 2-OG prior to loading on the analytical ENrich 650 column (BioRad Laboratories, Inc., Hecules, USA). The column was equilibrated with 50 mM Tris/HCl and 150 mM NaCl and supplemented with 5 mM 2-oxoglutarate when the complexes were preincubated in the presence of 5 mM 2-oxoglutarate and the applied proteins isocratic eluted with the respective buffer with a flow rate of 1 ml min-1 ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 and 8 using a BioRad TC10 Automated cell counter (BioRad Laboratories, Inc). Growth curves were conducted 5-times ...
-
bioRxiv - Plant Biology 2019Quote: ... The proteins were resolved on 8 or 10% SDS-PAGE (1610156, Bio-Rad) and transferred using the wet transfer method onto a nitrocellulose membrane (10600001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Cell Signaling Akt Panel 8-plex (BioRad, USA; LQ00006JK0K0RR) were used for phosphorylated protein quantification and Bio-Plex Pro Total Akt (BioRad ...
-
bioRxiv - Synthetic Biology 2021Quote: All SDS-PAGE gels contained 8% acrylamide bis-tris (Bio-Rad, pH 6.5). Samples were boiled in 1× Laemmli sample buffer at 90°C for 5 mins before loading to the gels ...
-
bioRxiv - Genomics 2019Quote: ... LIPC_F and LIPC_R (Supplemental Table 8)] by qPCR using SsoFast EvaGreen Supermix (BioRad), according to manufacturer’s protocol.
-
bioRxiv - Biophysics 2020Quote: Polyacrylamide (PAA) substrates were prepared by mixing 8% acrylamide (Bio-Rad, Hercules, CA), 0.1% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... or 0.2 mL white 8-tube PCR strips and optical caps (Bio-Rad). For bacterial cultures ...
-
bioRxiv - Pathology 2023Quote: ... 8 ng of cDNA was used for the SYBR green reagent (BioRad 1725270) reaction for qPCR analysis (BioRad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteins were separated using a 8-16% Mini-PROTEAN Precast Protein gels (BioRad) and transferred to Immobilon-P PVDF membrane (Millipore) ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... avara pased the quality checks (i.e., RIN > 8 in Experion, Bio-Rad, USA). In short ...
-
bioRxiv - Cancer Biology 2024Quote: SDS-PAGE Gels (8% or 10%) were transferred to nitrocellulose membranes (Bio-Rad) using a Trans-blot apparatus (2.5 A constant ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Molecular Biology 2022Quote: ... nucleic acid stain were imaged with ChemiDoc XRS+ Gel Imaging System (BIORAD). The 1 Kb Plus DNA Ladder (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... and agarose gel in tris/acetic acid/EDTA (Bio-rad, California, USA) were used for different stiffness ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Developmental Biology 2021Quote: Proteins from each sample were resolved using a precast 8-16% gradient gel (Biorad), and transferred to a PVDF membrane following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Products were detected by running an 8% acrylamide gel (19:1 acrylamide:bisacrylamide) (Bio-Rad), 1X TBE ...
-
bioRxiv - Genomics 2020Quote: Lysates were separated by SDS-PAGE on 3-8% Tris-acetate gels (BioRad #3450129) for 2.5 hours at 150V ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and cryostat sections (8 mm) were stained using rabbit anti-FITC (BioRad; 4510-780) and rat anti-CD31 (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... Bio-Plex Pro Mouse Cytokine 8-plex Assay kit (#M60000007A) (Bio-Rad, Hercules, CA).
-
bioRxiv - Biochemistry 2022Quote: ... The SDS-PAGE gel used weas a pre-cast 8-16 % gradient (Bio-Rad) and initially stained using Pro-Q™ Emerald 300 glycoprotein staining kit to highlight glycoproteins and subsequently stained with coomassie to visualise total protein ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on 8–16% Mini-PROTEAN® TGX Precast gels (Bio-Rad) and transferred onto 0.2 µm nitrocellulose membrane (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... and equal amounts were separated by 4–15% or 8–16% SDS-PAGE (BioRad) and blotted onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2020Quote: ... pH 8) and eluted by boiling the samples for Laemmli sample buffer (Bio-Rad). Eluates were collected from the beads by centrifugation and resolved on a NUPAGE 4-12 % Bis-Tris gel (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... 25ug of sample was loaded per well on 8-12% Bis-Tris gels (BioRad) and run for 2.5h/100V ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on gradient 8-16% Mini-Protean TGX precast gels (Bio-Rad) and transferred onto 0.45 μm pore nitrocellulose ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified whole cell lysates were run on a 8-16% SDS-PAGE gel (BioRad) and transferred to a nitrocellulose membrane (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... samples were run through Criterion XT Tris-acetate precast gels (3-8% gradient) (Biorad) in a XT tricine buffer (Biorad) ...
-
bioRxiv - Immunology 2023Quote: ... The lysates were separated by 8-16% pre-cast SDS-PAGE gels (Bio-Rad) and transferred onto PVDF membranes ...