Labshake search
Citations for Bio-Rad :
51 - 100 of 5152 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Western blots were performed either with Criterion ™ XT Tris-Acetate Precast Gels 3–8 % (3450130, Bio-Rad, Hercules, CA), XT Tricine running buffer (161–0790 ...
-
bioRxiv - Microbiology 2019Quote: ... was loaded onto 8-16% TGX gels (Bio-Rad) and run in SDS-PAGE buffer for 30 minutes at 90V followed by 45 minutes at 150 V ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gelatin (9000-70-8) was purchased from Bio-Rad. The reagents for RT-qPCR include the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: ... The membranes were blocked with 8% skim milk (BioRad) and incubated with mouse anti-trout IgM mAb or rabbit anti-trout IgT pAb as described in (10) ...
-
bioRxiv - Neuroscience 2020Quote: ... The samples were washed and then precipitated in 0.1 M glycine pH 3.5 and neutralized with 0.5 M Tris?Cl and 1.5 M NaCl pH 7.4 before SDS-PAGE electrophoresis (8%, at 100 V for 90 min) followed by transfer to a PVDF membrane (BioRad). Membranes were washed in Tris-buffered saline (TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... containing the crude synaptosomes was resuspended and processed for western blotting in NP-40 lysis buffer as above with the following modifications: equal amounts of protein per sample (unboiled) were separated on 3-8% Tris-Acetate XT gel (Bio-Rad) in XT Tricine running buffer (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... The dried pellets enriched for histones were dissolved in sample buffer (8 M urea, 5% β-mercaptoethanol and 10 mM Tris-HCl (pH 7.0)) and added sample loading buffer (Biorad XT sample buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 8% of 2% w/v bis-acrylamide (Bio-Rad, #1610142), 0.5% of 10% ammonium persulfate (APS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were resolved using 8% or 12% SDS-PAGE (BioRad) or 4-12% gradient NuPAGE Protein Gel (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... at 8°C in a MyCyclerTM thermal cycler (Bio-Rad). At the indicated intervals ...
-
bioRxiv - Neuroscience 2021Quote: ... 8) anti-CD68 (#MCA1957GA, Bio-Rad Laboratories, Hercules, CA, USA) and anti-Iba-1 (#019-19741 ...
-
bioRxiv - Biophysics 2020Quote: ... 8 mL of isopropanol-washed Affigel 10 resin (BioRad; # 1536099) was mixed gently in an Erlenmeyer flask for 20 h at room temperature with 48 mL of DMSO containing 24 mg of xanthine amine congener (XAC ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were resolved by SDS-PAGE (8-16%, Bio-Rad) and visualized by Coomassie staining ...
-
bioRxiv - Physiology 2019Quote: For serum fetuin-A analysis murine serum was separated by sodium dodecyl sulphate polyacrylamide gel elecrophoresis using mini gels (10% acrylamide, 5 × 8 × 0.1 cm3, BioRad, Hercules, USA). Protein transfer onto nitrocellulose membrane was by semi-dry electroblotting (Owl HEP-1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were separated by isoelectric focusing on immobilized linear pH gradient strips pH 5-8 for CDK4 (BioRad, Hercules, CA, USA) or pH 3–10 for CDK2 (Amersham Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were separated by isoelectric focusing on immobilized linear pH gradient strips (pH 5 to 8, Bio-Rad, Hercules, CA, USA) before separation by SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were washed 8 × 5 minutes in TBST and then ladder lanes were reacted with Precision Plus Strep Tactin HRP Conjugate (BioRad 1610380) diluted 1:10,000 in TBST ...
-
bioRxiv - Microbiology 2023Quote: ... Parasites were incubated with drug for 8 or 12 h (short or long assays, respectively) and stained with 5 μg/ml ethidium bromide (EtBr, Bio-Rad) for 10 min followed by immediate flow-cytometry analysis (Becton Dickinson ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:4 & 1:8) and loaded in triplicates onto a nitrocellulose membrane assembled in a 96-well dot-blot apparatus (Biorad, Cat#1703938). The membrane was then stained with Ponceau (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and 8 μg of protein was added from each sample to a 26-well Criterion TGX 4-20% precast gel (Bio-rad, 5671095). Proteins were transferred to an Immun-Blot low flouresence PVDF membrane (Bio-rad ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were boiled at 100 °C for 5 min and loaded in handcrafted 8% SDS-polyacrylamide gel or 4-12% Criterion™ XT Bis-Tris XT Precast Gels (Bio-Rad) and electrophoresed in 1X Tris/Glycine/SDS buffer (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein pellet was resuspended in UTC buffer (8 M urea, 2 M thiourea, 4% CHAPS) and quantified using RC DC™ Protein Assay Kit (Bio-Rad). Sample with 80 µg proteins resuspended in rehydration buffer (8 M urea ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were separated in 8% SDS-PAGE mini-gel (Bio-Rad), blotted to PVDF membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... DNA molecular weight standard (BioRad, CHEF DNA size 8-48-kb) was used as reference.
-
bioRxiv - Evolutionary Biology 2020Quote: ... then to 97°C for 8 min in a thermocycler (BioRad). We centrifuged the samples and froze the supernatant for further use.
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were analyzed in quadruplicate on 8-16% TGX gels (BioRad) that had previously been equilibrated in 0.5X TBE for 30 minutes at 150V ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 μl of 10% (w/w) tetramethylethylenediamine (TEMED, BioRad 161-0800) accelerator and 4 μl of 10% (w/w ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell were labelled with rabbit anti-IL-8 antibody (Biorad Biosciences), mouse anti-IL-1β antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with rabbit anti-IL-8 antibody (Biorad Biosciences) and mouse anti-IL-1β antibody (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Microbiology 2023Quote: ... for the selected clinical isolates using the indicated concentrations of antibiotics via an alamar blue reduction assay completed as described but without shaking.8 After 3 days of incubation with the alamar blue reagent (BioRad, Hercules, CA, USA), the MIC was identified as the lowest concentration of drug that inhibited the reagent color change as determined visually.
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: Frozen muscle biopsies were homogenised in modified Laemmli sample buffer as described previously.37 Samples were run in Bio-Rad Criterion 3–8 % tris-acetate gradient gels (Bio-Rad Laboratories, CA, USA) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... DNA libraries were amplified using 8 PCR amplification cycles (C1000, Bio-Rad). Cluster generation and sequencing was performed using the standard Illumina protocols for Illumina HiSeq 4000 by the University of Chicago Functional Genomics Core facility ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 8 minutes and images were acquired using a ChemiDoc (BIO-RAD). After removal of the Ponceau by washing once with TBS-T (TBS 1X ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracts were resolved on 8% (v/w) SDS-PAGE (1610156, Bio-Rad) and transferred onto a nitrocellulose membrane (0600001 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... in 0.2 ml 8-Tube PCR Strips (Bio-Rad™, clear #TBS0201) with 0.2 ml Flat PCR Tube 8-Cap Strips (Bio-Rad™ ...
-
bioRxiv - Plant Biology 2019Quote: ... The proteins were resolved on 8 or 10% SDS-PAGE (1610156, Bio-Rad) and transferred using the wet transfer method onto a nitrocellulose membrane (10600001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Cell Signaling Akt Panel 8-plex (BioRad, USA; LQ00006JK0K0RR) were used for phosphorylated protein quantification and Bio-Plex Pro Total Akt (BioRad ...
-
bioRxiv - Synthetic Biology 2021Quote: All SDS-PAGE gels contained 8% acrylamide bis-tris (Bio-Rad, pH 6.5). Samples were boiled in 1× Laemmli sample buffer at 90°C for 5 mins before loading to the gels ...
-
bioRxiv - Genomics 2019Quote: ... LIPC_F and LIPC_R (Supplemental Table 8)] by qPCR using SsoFast EvaGreen Supermix (BioRad), according to manufacturer’s protocol.
-
bioRxiv - Biophysics 2020Quote: Polyacrylamide (PAA) substrates were prepared by mixing 8% acrylamide (Bio-Rad, Hercules, CA), 0.1% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... or 0.2 mL white 8-tube PCR strips and optical caps (Bio-Rad). For bacterial cultures ...
-
bioRxiv - Pathology 2023Quote: ... 8 ng of cDNA was used for the SYBR green reagent (BioRad 1725270) reaction for qPCR analysis (BioRad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteins were separated using a 8-16% Mini-PROTEAN Precast Protein gels (BioRad) and transferred to Immobilon-P PVDF membrane (Millipore) ...
-
bioRxiv - Molecular Biology 2023Quote: ... avara pased the quality checks (i.e., RIN > 8 in Experion, Bio-Rad, USA). In short ...
-
bioRxiv - Cancer Biology 2024Quote: SDS-PAGE Gels (8% or 10%) were transferred to nitrocellulose membranes (Bio-Rad) using a Trans-blot apparatus (2.5 A constant ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Developmental Biology 2021Quote: Proteins from each sample were resolved using a precast 8-16% gradient gel (Biorad), and transferred to a PVDF membrane following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Products were detected by running an 8% acrylamide gel (19:1 acrylamide:bisacrylamide) (Bio-Rad), 1X TBE ...