Labshake search
Citations for Bio-Rad :
151 - 200 of 2104 citations for 7 methyloct 3 en 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred to a Minisize PVDF 7 membrane (BioRad) using a semi-dry transfer (TurboBlot ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PV1s (7 μg) and molecular weight marker (Dual Color, Bio-Rad) were transferred from SDS-PAGE 16% gels onto nitrocellulose membranes (Amersham ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Microbiology 2019Quote: ... allelic assignation was done using Quantity one software (Biorad®) to determine the length of the PCR products for each of the 24 loci analyzed ...
-
bioRxiv - Bioengineering 2020Quote: ... and data were analyzed using Quantity One (Bio-Rad, USA). For the dsDNA cleavage assays ...
-
bioRxiv - Neuroscience 2019Quote: ... The samples were analysis by Quantity One BioSoft (BIO-RAD). Relative expression levels were normalized to that of tubulin ...
-
bioRxiv - Cell Biology 2021Quote: ... and quantified using Quantity One version 4.1.0 software (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... and quantified using The Quantity One software v4.6.3 (Bio-Rad). Optical density values for CB1R were normalized to actin optical density values as loading control in the same sample and expressed as a percentage of control group (WT).
-
bioRxiv - Plant Biology 2021Quote: ... Hybridization results were quantified using Quantity One® (Bio-Rad) software ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unbound DNA was quantified by the Quantity One software (BioRad). The gel was subsequently stained with Simply Blue (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The analysis was done with the Quantity One software (BioRad). The experiment was conducted in five biological replicates.
-
bioRxiv - Physiology 2022Quote: ... Densitometry was performed using Quantity One 4.6.9 software (Bio-Rad).
-
bioRxiv - Bioengineering 2019Quote: ... with cumulative image recording using the Quantity One software (Biorad).
-
bioRxiv - Cancer Biology 2019Quote: ... then one hour and twenty minutes at 120 volts (Biorad) at 4oC ...
-
bioRxiv - Plant Biology 2020Quote: ... radioactivity counts were analyzed using Quantity One software (Bio-Rad). Statistical analysis was performed using GraphPad Prism software.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Densitometric scans were analyzed using Quantity One software (Bio-Rad). The value of the ricin band was determined as a percentage of the total protein in each lane ...
-
bioRxiv - Genetics 2021Quote: ... were quantified with Quantity-One software (Bio-Rad Laboratories, America). Sample in western blot was triplicate.
-
bioRxiv - Cancer Biology 2021Quote: ... The iTaq Universal SYBR Green One-Step Kit (Bio-Rad) was used to run the RT-qPCR reactions ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and quantified by The Quantity One software v4.6.3 (Bio-Rad). Optical density values for target proteins were normalized to Ponceau staining of the nitrocellulose membrane as loading control ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (36) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The signals were quantified using Quantity One software (Bio-Rad), and normalized to the last sample (set as 1) ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid 41 ...
-
bioRxiv - Bioengineering 2022Quote: iTaq Universal Probes One-Step Kit (Biorad, cat. no. 1725141)
-
bioRxiv - Developmental Biology 2022Quote: ... Expression was evaluated by Quantity One® (v4.6.7, Bio-Rad) densitometry to adjust for equal amounts of expression using WCL of untransfected cells to maintain total protein content ...
-
bioRxiv - Immunology 2022Quote: ... the iTaq Universal Sybr green One-step kit (Bio-Rad) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... or a QX ONE Droplet Digital PCR System (Bio-Rad) following the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... controlled by The Quantity One software v 4.6.9 (Bio-Rad). For quantitative purposes ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was activated using one-minute setting (Bio-Rad Imager ...
-
bioRxiv - Cell Biology 2023Quote: ... Band intensity was measured using Quantity One software (Bio-Rad). Quantitative ratios were calculated based on the data and are presented as relative values.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... and films were scanned and analysed using Quantity One (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... iTaq Universal SYBR Green One-step kit (Bio-Rad, Hercules, CA) with DENV-2 specific primers and following a standard protocol (S1 Table ...
-
bioRxiv - Neuroscience 2019Quote: ... and non-saturating signals were quantified using Quantity One software (BioRad).
-
bioRxiv - Neuroscience 2020Quote: ... Densitometry analysis was performed using the Quantity One software (Bio-Rad).
-
bioRxiv - Bioengineering 2020Quote: ... both using the iTaq universal SYBR green one-step kit (BioRad). For 1-step RT-qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... and the data were analyzed using Quantity One (Bio-Rad, USA).
-
bioRxiv - Bioengineering 2020Quote: ... and the data were analyzed using Quantity One (Bio-Rad, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... and were imaged using Quantity One Version 4.6 software (BioRad, U.K.).
-
bioRxiv - Molecular Biology 2022Quote: ... in combination with Quantity One software (Version 4.6.3. Bio-Rad Laboratories). Based on both total protein measurement and WB images of APOA1 ...
-
bioRxiv - Immunology 2022Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (72) ...
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... Densitometric analyses were performed using Quantity One 1-D software (BioRad).
-
bioRxiv - Cell Biology 2020Quote: ... iTaq Universal SYBR Green One Step Kit (Bio-Rad, Cat#1725150) was used to carry out one-step qRT-PCR and reactions were performed using 300ng of RNA ...
-
bioRxiv - Microbiology 2020Quote: ... the One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad) was applied according to the supplier’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with primers and probes (Table S1 ...