Labshake search
Citations for Bio-Rad :
101 - 150 of 8520 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Transfer buffer was prepared as a 1X final solution by mixing 7:2:1 of ddH2O: methanol: 10X Tris/Glycine Transfer Buffer (Bio-Rad #1610734). Following transfer ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Plant Biology 2020Quote: ... Plates were incubated for 30 °C for 5 or 7 days and imaged using a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Synthetic Biology 2020Quote: ... under constant electric current of 0.1 A per gel and voltage of 5-7 V using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad, USA). Alternatively ...
-
bioRxiv - Immunology 2021Quote: ... P2 was dialyzed against 1% glycine containing 2% ampholytes pH 3-10 (first run) or pH 5-7 (second run) and then loaded onto a liquid isoelectric focusing system (Rotofor, Bio-Rad). Individual fractions were harvested and their pH and absorbance at 280nm were measured ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were then blocked for 1 h at 25 °C with 5% non-fat dry milk (BioRad) in TBST (50 mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 1 h at room temperature in 5% skim milk (Catalog #170-6404, Bio-Rad). Primary antibody incubations were performed overnight at 4°C with antibodies diluted in TBS/0.1% Tween-20/5% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were diluted 1:1000 in PBS-T containing 5% blotting-grade blocker (Bio-Rad, #1706404). Membranes were incubated overnight (≈16 h) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Synthesized cDNA was diluted 1:10 and 5 µl mixed with SsoAdvanced Universal Sybr Green supermix (Biorad). qPCR was performed using the Biorad CFX96 PCR machine ...
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... Densitometric analyses were performed using Quantity One 1-D software (BioRad).
-
bioRxiv - Molecular Biology 2019Quote: ... Either regular (Figure 4 and 5) or stain-free (Figure 8 and 9, Bio-Rad #1610182) 10 % acrylamide gels were used ...
-
bioRxiv - Cell Biology 2020Quote: ... then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... boiled for 5 minutes and resolved on 4 to 20% TGX mini protean gels (Bio-Rad). The proteins were transferred to PVDF membranes using BioRad Trans-Blot semi-dry transfer ...
-
bioRxiv - Bioengineering 2019Quote: ... for 5 min at 95 °C and loaded into a 4– 15% polyacrylamide gel (Bio-Rad). Proteins were transferred to a 0.45 µm PVDF membrane (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg of sample were loaded on a 4-to-20% SDS polyacrylamide gel (Bio-Rad). Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl ...
-
bioRxiv - Immunology 2022Quote: ... diluted to 1:5,000 in 1X TBST 5% milk powder for 1 hour before visualisation with Clarity™ Western ECL Substrate (Bio-Rad, Hercules, California, US) using a Syngene G ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were sonicated and heated at 95°C for 5 minutes before their separation on a 4-15% gradient SDS PAGE gel (Biorad, 4-15%). Proteins were transferred from gel to nitrocellulose membrane using semi-dry method ...
-
bioRxiv - Cell Biology 2024Quote: 2-10ug of RNA extractions were loaded into a 5% acrylamide (Bio-Rad Laboratories: 1610156), 0.5x TBE (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA fragments was separated on 20% denaturing acrylamide gel (5% crosslinker, 7 M urea, 1X TBE buffer) using Criterion™ cell apparatus (Bio-Rad) at 300 V for 40 to 60 minutes ...
-
bioRxiv - Genetics 2019Quote: ... One volume of 2% low melt agarose (Bio-Rad) in TSE was added and the suspension dispensed into plug molds ...
-
bioRxiv - Cell Biology 2020Quote: ... TBST (50 mM Tris-HCl pH 7.4, 1% Triton X-100) with 5% non-fat milk (Bio-Rad) was used for blocking ...
-
bioRxiv - Genetics 2021Quote: ... Samples were then diluted 1:5 and placed into a 96 well plate with Supermix (no dUTPs, BioRad) and the required target locus primers and MGB-NFQ probes (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesized with 1-5 μg of RNA using iScript cDNA synthesis kit (Bio-Rad). mRNA levels were measured using qRT-PCR with SYBR Green Master Mix (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunohistochemistry was performed on paraffin sections (5 μm) using antibody F4-80 (Bio-rad, France; diluted 1:100). Sections were incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 min) and incubated for 1 h at room temperature with goat anti-rabbit IgG (H+L) (BioRad). Membranes were washed and signal was detected using the ChemiDoc XRS+ (Biorad ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were blocked for 1 h at rtp with 5% (w/v) non-fat milk block (Bio-Rad) in 1x TBS (in mM ...
-
bioRxiv - Physiology 2021Quote: ... Membranes were blocked 1 hour in skim milk 5% TBS-Tween buffer (TBST, Bio-Rad, 0.05% Tween 20), and incubated overnight with the primary antibodies diluted in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked for 1 h at room temperature with 5% non-fat dry milk (Bio-Rad Laboratories) in Tris-buffered saline (TBS ...
-
bioRxiv - Physiology 2021Quote: ... membranes were rinsed three-times in TBS/0.2% Tween for 10min and incubated for 1h with goat secondary anti-rabbit or anti-mouse IgG linked to peroxidase (dilution 1:5,000; Biorad) in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Genomics 2022Quote: ... membranes were rinsed threetimes in TBS/0.2% Tween for 10min and incubated for 1h with goat secondary anti-rabbit IgG linked to peroxidase (dilution 1:5,000; Biorad) in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Molecular Biology 2019Quote: ... RLUC was detected with a primary anti-RLUC (MBL Life Sciences PM047) 1:2000 in TBST 5% BSA and a secondary anti-Rabbit IgG-HRP (Bio-Rad 170-6515; 1:10000) antibody in TBST 5% milk ...
-
bioRxiv - Immunology 2023Quote: Plasma from control and infected mice was used at a 1:2 and 1:4 dilution with the Bio-Plex Pro Mouse Cytokine 23 Plex Immunoassay (Bio-Rad Laboratories, Inc., CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-YL1/2 (1:1000, BioRad) primary antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... which then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... Denatured protein lysates (5 μg) were loaded in 4–20% Criterion TGX Precast Gels (Bio-Rad, 5678095) and transferred to Immobilon-FL PVDF membrane (0.45 μm pore ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated overnight at 4°C with primary antibodies dissolved in 5% Blotting-Grade Blocker (Bio-Rad). All primary antibodies and dilutions used are listed in Supplementary Table STm.1 ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... boiled for 5 min and loaded on a 4-15% Criterion TGX Stain-Free precast gel (BioRad). Protein samples were transferred unto a PVDF membrane (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... All samples were acquired on a ZE5 5-laser or 4-laser cell analyzer (Bio-rad laboratories) and analyzed with FlowJo software (Tree Star) ...
-
bioRxiv - Genomics 2023Quote: ... 10% glycerol) containing 5% ß-mercaptoethanol before SDS-PAGE on a 4-15% polyacrylamide gel (Bio-Rad). Proteins were transferred onto a nitrocellulose membrane blocked with AdvanBlock-Chemi blocking solution (Advansta ...
-
bioRxiv - Biochemistry 2023Quote: mtHsp60V72I (10 μL of 5 μM monomer) was loaded on a 4-15% TGX gel (Bio-Rad), run for 30 min at 200 V ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% of the lysates were boiled with 2 x laemmli buffer (BIO-RAD, Hercules, CA, USA) and used as input ...