Labshake search
Citations for Bio-Rad :
1 - 50 of 4148 citations for 7 chloro 5 methylpyrazolo 1 5 A pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Immunology 2020Quote: ... Siglec-7 (5-386, Alexa Fluor 488, Bio-Rad), TIM-3 (7D3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Plant Biology 2020Quote: ... Plates were incubated for 30 °C for 5 or 7 days and imaged using a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Synthetic Biology 2020Quote: ... under constant electric current of 0.1 A per gel and voltage of 5-7 V using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad, USA). Alternatively ...
-
bioRxiv - Immunology 2021Quote: ... P2 was dialyzed against 1% glycine containing 2% ampholytes pH 3-10 (first run) or pH 5-7 (second run) and then loaded onto a liquid isoelectric focusing system (Rotofor, Bio-Rad). Individual fractions were harvested and their pH and absorbance at 280nm were measured ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL diluted cDNA (5 ng) in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each experimental sample (four source colonies ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were mixed with Bradford reagent (1:5; Bio-Rad) and absorbance was measured at 595 nm ...
-
bioRxiv - Molecular Biology 2024Quote: ... were used at 1:5000 in 5% Blotting-Grade Blocker (BioRad).
-
bioRxiv - Plant Biology 2020Quote: ... we used 2 µl of a 1/5 dilution of the cDNA obtained as above in a reaction containing 5 µl of SsoFast EvaGreen (Bio-Rad, USA), 0.5 µl of Forward primer (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA fragments was separated on 20% denaturing acrylamide gel (5% crosslinker, 7 M urea, 1X TBE buffer) using Criterion™ cell apparatus (Bio-Rad) at 300 V for 40 to 60 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubated for 1 h with 5% blotting grade blocker (Bio-Rad). Primary antibodies were incubated overnight at 4℃ and secondary HRP-conjugated antibodies were incubated for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... After 1 h blocking (5% non-fat milk, Bio-Rad 170–6404) at room temperature (RT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Neuroscience 2019Quote: ... After being blocked with TBST (1%) containing 5% blotting-grade blocker (Bio-Rad), the membranes were incubated overnight with primary antibodies against target molecules at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked in 5% nonfat dry milk for 1 hour (Bio-Rad) and incubated gently shaking overnight at 4°C in 1° antibody/PBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... and blocked for 1 h with 5% non-fat milk (Bio-Rad Laboratories) or BSA (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked for 1 h with 5% nonfat milk powder (Bio-Rad) in TBS + 0.05% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% Tween]) or for 5 min in EveryBlot blocking buffer (Bio-Rad, #12010020) before proceeding to primary and HRP secondary antibody staining in the respective blocking buffers ...
-
bioRxiv - Microbiology 2023Quote: ... sheep polyclonal anti-GFP (Bio-Rad, 4745-1051, 1:1000, 5 µg/mL), and rabbit polyclonal anti-GFP (Novus Biologicals ...
-
bioRxiv - Biophysics 2019Quote: ... containing 5% 2-mercaptoethanol (Bio-Rad), electrophoresed by SDS-PAGE and blotted onto nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... at 100V for 1 hour and blocked for 1 hour with 5% non-fat milk (Bio-Rad) before incubation at 4 C overnight with appropriate primary antibodies ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% FBS for 1 hour and incubated with anti TGN46 antibody (#AHP500GT, BioRad, 1:2000) at 4°C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... Nonspecific binding was blocked for 1 hr at RT with 5% BLOTTO (Bio-Rad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Neuroscience 2020Quote: ... After 1 hour blocking in 5% non-fat milk solution (Bio-Rad 170-6404) at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked for 1 hr using 5% non-fat dry milk (Bio-Rad) and incubated with primary antibody overnight at 4 °C ...
-
bioRxiv - Bioengineering 2019Quote: ... Membranes were blocked for 1 h with 5% fat free milk powder (Bio-Rad) in TBS + 0.05% tween-20 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2019Quote: ... Nonspecific binding was blocked for 1 h at room temperature with 5% blotto (Biorad) in Tris-buffered saline with 0.1% Tween (TBST) ...