Labshake search
Citations for Bio-Rad :
201 - 250 of 8279 citations for 7 CHLORO 4 NITRO 5 PIPERIDINO 2 1 3 BENZOXADIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The membranes were incubated overnight at 4°C in blocking solution 5% (w/v) Blotting-Grade Blocker (BioRad) in PBS-Tween buffer (1× PBS ...
-
bioRxiv - Cell Biology 2022Quote: Equal volumes (5 µg) of the prepared co-IPs were separated by SDS-PAGE (4–15%, Bio-Rad) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Physiology 2019Quote: ... qPCR was performed using Taqman probes for β-actin (assay #Mm02619580_g1) and MMP13 (assay #Mm00439491_m1 which targets exons 4-5) and using iQ SYBR Green Supermix (BioRad) with β-actin as the housekeeping gene (primer sequences given in Supp ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated 5 min at 95 °C and separated on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins could be detected with an infrared imager (Odyssey ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated at 95°C for 5 min then run on a 4-12% Bis-Tris gel (BioRad 3450125). The input sample is identical to the initial solution containing protein in 60 μL 1x selection buffer prior to capture with 20 passages over the ME200 tip ...
-
bioRxiv - Neuroscience 2023Quote: ... with 5% β-Mercaptoethanol then loaded on 4-20% Criterion TGX Precast Midi protein gels (Bio-Rad #5671094). The gels were run in TGS buffer (1x ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% of the lysates were boiled with 2 x laemmli buffer (BIO-RAD, Hercules, CA, USA) and used as input ...
-
bioRxiv - Molecular Biology 2022Quote: ... boiled for 2 min and then analyzed on a 4–20 % SDS-PAGE gradient gels (Bio-Rad). The protein bands were then transferred to a nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2024Quote: ... Detergent removal was carried out at 4°C via incubation with Bio-Beads SM-2 (Bio-Rad) at a concentration of 200 mg ml-1 for three times with two hours for each time ...
-
bioRxiv - Plant Biology 2024Quote: ... centrifuged for 2 minutes before running through 4-20% mini Protean TGX Stain Free Gel (BioRad, USA). The separated proteins were transferred to Immobilon®-P PVDF membrane (Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... or at 100 V for 2 h at 4 °C using the wet transfer method (Bio-Rad Mini Trans-Blot Electrophoretic Cell 170-3930) ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were diluted 1:4 with Laemmli sample buffer (Bio-Rad), incubated for 95°C (5min) ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-tubulin YL1/2 (dilution 1:50; Biorad) and guinea-pig anti-Ana1 (dilution 1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were resolved on native acrylamide gels containing 0.5X TBE buffer and 7% acrylamide (made from a stock of 40% acrylamide with a ratio of 29:1 acrylamide:bisacrylamide; Bio-Rad). The running buffer for the gels was 1XTBE ...
-
bioRxiv - Bioengineering 2019Quote: Native PAGE gels were prepared as follows: a fresh solution comprising of polyacrylamide (19:1) at final concentrations from 7 to 13% (Biorad), 0.5x TBE buffer (45 mM Tris-borate ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated in vitro by PLK-1 or CyclinB-Cdk1 as described (7) were separated on stain Free SDS-PAGE 10% gel (Biorad). The gel was imaged and then transferred to a PVDF membrane 0.45 µm during 1h30 at 90V ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Immunology 2020Quote: ... Samples were heated at 95°C for 3 minutes and run on a 8 – 16% or 4 – 20% TGX-Criterion gel (Bio-Rad). The separated proteins were transferred to PVDF membranes and blocked in PBS containing 0.2% fish skin gelatin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Bioengineering 2021Quote: ... and probed overnight at 4°C with IRDye 680 Streptavidin (LICOR) diluted 1:3000 in 1:1 TBST:Blocking Buffer (BioRad). Membranes were imaged using an Azure Biosystems c600 ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples were boiled for 5 min and equal volumes were loaded onto a 4-15% gradient gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Developmental Biology 2020Quote: ... the membrane was blocked overnight at 4°C using 5% non-fat dry milk (Bio-Rad, catalog 170-6404) in Tris-buffered saline pH 7.3 ...
-
bioRxiv - Neuroscience 2019Quote: ... ~5 μg of protein per lane was separated on 4-15% TGX gels (Bio-Rad Laboratories, Hercules, CA, USA) at 200V for 40 minutes in tris-glycine running buffer (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... Samples (5 μL) were then loaded on precast gradients (4-15%) SDS-polyacrylamide gels in duplicate (Bio-Rad Laboratories) and subjected to electrophoresis at 180 V for 40 minutes using pre-made 1x SDS-PAGE running buffer (Ameresco) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... pH 8.3) running buffer by loading 5 μg sample onto 4-20% Mini-PROTEAN® TGXTM gels (Bio-Rad) with iBrightTM Prestained Protein Ladder (#LC5615 ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein samples were heated at 95°C for 5 minutes and 10µL were loaded on SDS-PAGE gels (4-20%Mini-PROTEAN TGX Stain-Free, BioRad). After electrophoresis ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µL of the supernatant was loaded into a 4−20 % Mini-PROTEAN-TGX gel (BioRad, Hercules, CA, USA), run at 165 V for 50 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg/sample was loaded onto 4-15% gradient polyacrylamide gels (Mini-PROTEAN TGX Gels, Bio-Rad, 4561083), transferred (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: ... Total protein (5∼15 µg) was loaded and separated by 4–20% pre-made SDS-PAGE gels (#4568095, BioRad, Mini-PROTEAN TGX Stain-Free Precast Gels ...
-
bioRxiv - Microbiology 2019Quote: ... Relative fluorescence was measured at 5-minute intervals for 2 hours in a CFX96 system (Bio-Rad).
-
bioRxiv - Developmental Biology 2019Quote: ... 2 μl of gene-specific primer pair and 5 μl iTaq Universal SYBR Green Supermix (Bio-Rad). The relative transcript abundance of each gene (normalized to rpl4 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... protein extracts were prepared in lysis buffer with 2% SDS and resolved in a 4-12% gel (Biorad). Membranes were probed overnight at 4°C ...
-
bioRxiv - Genomics 2023Quote: ... proteins were transferred (80 V; 2 h; 4°C) onto a 0.2 µm nitrocellulose membrane (Bio-Rad 1620112). Membranes were air-dried ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We used 1 μL diluted cDNA (1:3 in ddH2O) and iTaq Universal SYBR Green Supermix (Bio-rad) in the Bio-rad CFX96 real-time PCR detection system for qPCR experiments ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μL of SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and RNase-free water for a final reaction volume of 15 μL in each well ...
-
bioRxiv - Developmental Biology 2022Quote: ... 7×8.5 cm precut nitrocellulose membranes (BioRad, cat. #162-0146), at 4°C with magnetic stirring and an opposing cold-pack ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR was conducted using the QuantumStudio-7 (Bio-Rad). mRNA expression levels were quantified by real-time PCT using SYBR green fluorescence ...
-
bioRxiv - Neuroscience 2024Quote: ... for 7 min using Trans Blot Turbo System (Bio-Rad). Filters were washed three times and blocked for 1 hour in Tris-Tween buffered saline (TTBS ...