Labshake search
Citations for Bio-Rad :
101 - 150 of 590 citations for 7 CHLORO 3 METHYL 1H INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed in 7 min at 1.3 A and 25 V using a Trans-Blot TurboTM transfer system (BioRad). Recognition and revelation of the his-tagged protein was performed as described for the Dot Blot ...
-
bioRxiv - Neuroscience 2019Quote: ... “any kD” (to quantify GDNF protein) or 7% (to quantify CBP) precast polyacrylamide gel (Bio-rad, Hercules, Cal, USA) and transferred to a polyvinylidene difluoride membrane (PVDF ...
-
bioRxiv - Microbiology 2020Quote: ... in 0.5×TBE buffer at 4 to 7 °C for 260 h using a CHEF Mapper System (Bio-Rad). Switching time was 1,200 to 4,800 s at 1.5 V/cm with an included angle of 120° ...
-
bioRxiv - Molecular Biology 2022Quote: ... LarA extracted from a 7 cm prep well Mini-PROTEAN® TGX Stain-Free™ gel (#4568091, Bio-Rad) was used for affinity purification of the final antibody.
-
bioRxiv - Synthetic Biology 2022Quote: ... The reaction was run for 7 h at 34 °C on a CFX96 real-time PCR detection system (Biorad) and monitored thanks to the SYBR Green II signal.
-
bioRxiv - Biochemistry 2023Quote: ... The gels were then transferred to a water-activated nitrocellulose membrane at 1.3A to 25V for 7 minutes (BioRad TurboBlotter ...
-
bioRxiv - Microbiology 2023Quote: ... for 7 min at 2.5A and 12V using a Trans-Blot® Turbo™ Transfer System (Bio-Rad #1704150EDU). Membranes were saturated in PBS (137 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were separated on 15% SDS-PAGE and were transferred to PVDF membrane under 2.5A/25V condition for 7 min using a semidry transfer system (Trans-Blot Turbo, BioRad). Transferred membranes were first blocked by TBS-Tween20 (0.1% ...
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by incubation at 37 °C for up to 7 hours on a real-time qPCR instrument (Biorad, CFX96). To measure the time-dependent change in fluorescence ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 2% w/v CA and treated with (7% w/v) Chelex100 resin (Bio-Rad, Mississauga, ON, Canada) at 4°C overnight ...
-
bioRxiv - Immunology 2024Quote: ... was introduced by electroporation (7 square wave pulses of 30 V, 3ms, 0,1s pause) using a GenePulser Xcell electroporator (Biorad) and a 1 mm cuvette (Biorad) ...
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Neuroscience 2022Quote: ... and analyzed with Opticon Monitor 3 and GeneX (BioRad) software ...
-
bioRxiv - Molecular Biology 2023Quote: ... from a 3% low range agarose gel (BioRad, 1613107) to remove adapter dimers.
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed in 3% paraformaldehyde (Bio-rad) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Genetics 2021Quote: ... Proteins (7 μl of extract) were separated on Laemmli SDS-PAGE gels and transferred to nitrocellulose membranes (Bio-Rad, 1620112). Membranes were stained with Ponceau-S for visualization ...
-
bioRxiv - Immunology 2021Quote: ... A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad) and 0.25 μL of Fluidigm’s DNA Binding Dye Sample Loading Reagent in a separate plate and centrifuged to mix solutions ...
-
bioRxiv - Plant Biology 2021Quote: ... Total proteins were separated by electrophoresis in 7% SDS-polyacrylamide gels and electrophoretically transferred to a polyvinylidene fluoride membrane according to the manufacturer’s protocol (Bio-Rad). Transferred proteins were detected with Ponceau-S ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred onto nitrocellulose membranes using either a Trans-Blot® Turbo™ Transfer System (7 minutes, 25V, BioRad) or an iBlot™ 2 Dry Blotting System (P0 method ...
-
bioRxiv - Molecular Biology 2020Quote: ... Running buffer was prepared with tris-glycine 1X and SDS 0.1% using a homemade gel (7-12% bis-acrylamide, Bio-Rad), which ran at 100 V for approximately 2:30 h ...
-
bioRxiv - Biochemistry 2022Quote: ... Insoluble material was pelleted by repeated ultracentrifugation and the supernatant recovered and loaded onto an hydroxyapatite column (7 g dry-weight resin, Biorad 130-0420, hydrated and packed in a disposable chromatography column, Biorad 732-1010 ...
-
bioRxiv - Biochemistry 2022Quote: ... Insoluble material was pelleted by repeated ultracentrifugation and the supernatant recovered and loaded onto an hydroxyapatite column (7 g dry-weight resin, Biorad 130-0420 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were resolved on native acrylamide gels containing 0.5X TBE buffer and 7% acrylamide (made from a stock of 40% acrylamide with a ratio of 29:1 acrylamide:bisacrylamide; Bio-Rad). The running buffer for the gels was 1XTBE ...
-
bioRxiv - Physiology 2022Quote: ... and was and then electrophoretically separated at 240V for 22 minutes on a 7-12% TGX gradient gel (BioRad, 4568081). Proteins were then transferred to a PVDF membrane using a BioRad Trans Blot Turbo ...
-
bioRxiv - Biochemistry 2019Quote: ... autophosphorylation reactions were separated on SDS-PAGE gels and transferred to 0.2 µm nitrocellulose membranes at 25 V for 7 mins using Trans-Blot Turbo Transfer system (Bio-Rad). Membranes were blocked with BSA and incubated with primary mouse anti-phosphotyrosine antibody (PY20 ...
-
bioRxiv - Bioengineering 2019Quote: Native PAGE gels were prepared as follows: a fresh solution comprising of polyacrylamide (19:1) at final concentrations from 7 to 13% (Biorad), 0.5x TBE buffer (45 mM Tris-borate ...
-
bioRxiv - Genetics 2020Quote: ... Cell lysates were clarified by centrifugation at 6,000 rpm for 7 min and protein concentration was determined using a DC protein assay kit (Bio-Rad). Samples containing equal amounts of protein were brought to a total volume of 1 ml with appropriate buffer.
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... The protein extract was solubilized in 2-D lysis buffer (30 mM Tris-HCl pH 8.8, containing 7 M urea, 2 M thiourea and 4% CHAPS. Protein concentration was measured using Bio-Rad protein assay method ...
-
bioRxiv - Microbiology 2023Quote: ... gels were briefly washed with water and proteins were transferred (25 V, 1.3 A, 7 min) onto nitrocellulose membranes (Bio-Rad) using Bio-Rad Trans Blot Turbo Transfer system ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated in vitro by PLK-1 or CyclinB-Cdk1 as described (7) were separated on stain Free SDS-PAGE 10% gel (Biorad). The gel was imaged and then transferred to a PVDF membrane 0.45 µm during 1h30 at 90V ...
-
bioRxiv - Biochemistry 2023Quote: ... 15 µL bound and 7 µl input sample was separated on 4-15% TGX SDS-PAGE gel (BioRad #456-1086) and transferred to PVDF membrane (Immobilon-FL ...
-
bioRxiv - Plant Biology 2023Quote: Shoot apices of reporter lines were dissected and fixed in 4% paraformaldehyde for 1 hour and embedded in 7% ultra low range agarose gel (BioRad). Fifty µm sections were prepared using a vibratome DTK-1000 (Dosaka ...
-
bioRxiv - Neuroscience 2023Quote: ... High integrity RNA (RIN > 7) was used to synthesize cDNA with iScript™ gDNA Clear cDNA Synthesis Kit (Bio-Rad). PCR primers for human B-ACTIN ...
-
bioRxiv - Cell Biology 2023Quote: ... and were then transferred to polyvinylidene difluoride (PVDF) membrane using a semi-dry method with a Trans-Blot Turbo system for 7 minutes at 25V (BioRad). The membranes were probed with the rabbit polyclonal antibody against an amino-terminal region of β1 [21] ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 3 separate transformation reactions (1200 V, 200 Ω, BioRad). Transformation reactions were plated on 10 separate 15cm LB-agar plates with 100ug/mL ampicillin selection at 30°C for 48 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1:1000, BioRad). As secondary antibodies Horseradish Peroxidase (HRP ...