Labshake search
Citations for Bio-Rad :
51 - 100 of 678 citations for 7 Benzyloxy 1H indole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... And then blots were probed with secondary antibodies for 1h at room temperature before ECL development and imaging (Bio-Rad). The primary antibodies used for immunoblotting are as follows ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μL of SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and RNase-free water for a final reaction volume of 15 μL in each well ...
-
bioRxiv - Developmental Biology 2022Quote: ... 7×8.5 cm precut nitrocellulose membranes (BioRad, cat. #162-0146), at 4°C with magnetic stirring and an opposing cold-pack ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR was conducted using the QuantumStudio-7 (Bio-Rad). mRNA expression levels were quantified by real-time PCT using SYBR green fluorescence ...
-
bioRxiv - Neuroscience 2024Quote: ... for 7 min using Trans Blot Turbo System (Bio-Rad). Filters were washed three times and blocked for 1 hour in Tris-Tween buffered saline (TTBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Slides were then washed in PBS and blocked for 1h in 20 mm Tris Buffered Saline with 0.1% Tween-20 (BioRad, catalog #1610781) (TBS-T ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nitrocellulose membranes were blocked for 1h at RT in 5% Blotting Grade Blocker Non-Fat Dry Milk (Biorad, Hercules, CA, USA) and TBST ...
-
bioRxiv - Immunology 2024Quote: ... the proteins were transferred to a polyvinylidene difluoride membrane (110V, 1h, 4°C) using a Mini Trans-Blot cell apparatus (Bio-Rad). Non-specific binding sites were blocked using PBS/Tween 20 (0.05% Tween 20 ...
-
bioRxiv - Microbiology 2021Quote: ... for 7 min in a Trans-Blot Turbo Transfer System (BioRad). Membranes were blocked with 3% BSA in TBST and incubated with mouse anti-His monoclonal antibody overnight in a cold room ...
-
bioRxiv - Cell Biology 2019Quote: ... and droplet generation oil (Bio-rad, 1864006; 7 ml per run), were connected to a microfluidics device (FlowJEM ...
-
bioRxiv - Immunology 2021Quote: ... and mouse anti-pig CD203a-FITC (clone PM18-7; Bio-Rad). Granulocytes were defined as 2B2+CD203a- ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred to a Minisize PVDF 7 membrane (BioRad) using a semi-dry transfer (TurboBlot ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PV1s (7 μg) and molecular weight marker (Dual Color, Bio-Rad) were transferred from SDS-PAGE 16% gels onto nitrocellulose membranes (Amersham ...
-
bioRxiv - Bioengineering 2020Quote: ... the 96-well microplate was incubated at 37 °C for 1h and the end-point image was taken by ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... Secondary antibody incubation was done at room temperature for 1h (HRP-conjugated goat anti-rabbit IgG, 1:2000 dilution, Bio-Rad, 403005). Membranes were washed with Tris-buffered saline containing 0.05% (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... PAGE gels were run at 130V for ∼1h in Bis-Tris buffer (GeneScript) and then wet transferred to a 0.2 µm PVDF membrane (BioRad, activated in 100% methanol) at 100V for ∼1 h in 1X transfer buffer containing 20% methanol ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Densitometry analysis was carried out using Image Lab (v6.1.0 build 7, Bio-Rad, SG). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Genomics 2019Quote: ... transferred to PVDF membranes using the TurboTransfer System for 7 min at 25 V (BioRad) and blocked for 1 hr with TBS ...
-
bioRxiv - Biophysics 2023Quote: GAGs were purified with a column of 7 mm diameter and 10 cm length (BioRad) packed with Sephadex G25 resin (Sigma-Aldrich # G25150) ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µg of each extract was loaded on 7-12% precast SDS-polyacrylamide gels (Bio-Rad). After transference ...
-
bioRxiv - Microbiology 2019Quote: ... For WB proteins were transferred (25 V, 1.3 A, 7 min) onto nitrocellulose membranes (Bio-Rad) using Bio-Rad Trans Blot Turbo Transfer system ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 μL RNase-free water and 10 μL iQ SYBR○R Green Supermix (Bio-Rad, USA). The standard curves were constructed from a series of 10-fold dilutions of a plasmid DNA obtained by TOPO TA cloning (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Standard SDS-PAGE was performed with BioRad 7-12% TGX gels (4561086; BioRad, Hercules, CA, USA) and polyvinylidine difluoride (PVDF ...
-
bioRxiv - Plant Biology 2024Quote: ... consisting of 7 μL Sso Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.28 μL of each primer (10 μM) ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Molecular Biology 2022Quote: ... nucleic acid stain were imaged with ChemiDoc XRS+ Gel Imaging System (BIORAD). The 1 Kb Plus DNA Ladder (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... and agarose gel in tris/acetic acid/EDTA (Bio-rad, California, USA) were used for different stiffness ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction products were resolved on 15% denaturing PAGE gel with 7 M Urea (Bio-Rad #3450091), and was exposed to a phosphor screen (Amersham ...
-
bioRxiv - Microbiology 2021Quote: ... and final extension at 72°C for 7 min using a C1000 Touch Thermal Cycle (BIO-RAD). PCR results were run on 1% agarose gels and imaged using an iBright CL1500 Imaging system (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... for 7 min with a constant 2.5 A using a Trans-Blot Turbo transfer system (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... for 7 minutes and separated with 4-20% Mini-PROTEAN TGX protein Gel (Bio-Rad, Cat # 5671094), transferred to nitrocellulose membranes according to standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The WB samples were loaded on a 4-20% or 7% Midi CriterionTM TGXTM Precast gel (BioRad) and ran at 180V for 45min in 1x running buffer (190mM glycine ...
-
bioRxiv - Microbiology 2023Quote: ... 7 µg of each cell extract was loaded on a 12% stain-free SDS-PAGE gel (BioRad) and separated by gel electrophoresis at 175 V for 45 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and heated at 95°C for 7 min prior to separation by 10% SDS-PAGE (BioRad Laboratories). Following electrophoresis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...