Labshake search
Citations for Bio-Rad :
601 - 650 of 1550 citations for 7 Benzothiazolecarboxylicacid 2 3 dihydro 2 thioxo methylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... and then the WBC solutions were embedded into 2% agarose plugs (CHEF Genomic DNA Plug Kit, Bio-Rad) to avoid fragmentation of long DNA molecules ...
-
bioRxiv - Developmental Biology 2020Quote: ... Smit1/2 and TonEBP were measured by real time qPCR using SYBR Green I (Bio-Rad, Mississauga ON) and 5 μM of forward and reverse primer mix (Bio-Rad CFX384 ...
-
bioRxiv - Genetics 2021Quote: ... The enriched proteins were dissociated by the addition of 2 x Laemmli sample buffer (161-0737, Bio-Rad) and boiled at 95 °C for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: KirBac3.1 protein was buffer-exchanged to 200 mM ammonium acetate (pH=8.0) with 0.5% C8E4 (2×CMC) using a Biospin-6 column (BioRad). The protein sample was loaded into a gold coated needle prepared in-house and analysed on a modified Q-Exactive mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... Gels were dried for 2 h at 80°C and analysed on a Personal Molecular Imager (Bio-Rad). For RNA stability assays ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of RNA were mixed with 2 μl of 50 μM oligo dT primer (Bio-Rad, 1725038) and 1 μl of 25 mM dNTP mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-α-tubulin YL1/2 from rat (MCA77G, Bio-Rad AbD Serotec, at 1:2000 dilution for IF), anti-rabbit Alexa Fluor 488 (A11008 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μl of the cDNA sample were supplemented with 5 μL of SsoADV Universal SYBR Green Supermix (BioRad) mix 2X ...
-
bioRxiv - Genetics 2019Quote: ... the size of the amplicon was determined by comparison with a 2-kb DNA marker with the use of Quantity One software (version 4.6.7; Biorad), and the number of repetitions was estimated by comparing the size of the product amplified from the Nichols strain ...
-
bioRxiv - Plant Biology 2022Quote: ... For α-ACTIN-2 the secondary antibody Goat Anti-Mouse IgG (H + L)-HRP conjugate (1706516, Bio-rad) was used at a dilution of 1:5000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Captured proteins were separated from beads by incubating beads in 50 μl 2× Laemmli Sample Buffer (Bio-Rad) at 95°C for 25 min ...
-
bioRxiv - Immunology 2022Quote: ... 200 μL of this transformation mix was then aliquoted into pre-chilled 2 mm electroporation cuvettes (Bio-Rad) and electroporated at 1500 V with an average time constant of ∼4.5 ms using a Gene Pulser Xcell Electroporation System (Bio-Rad) ...
-
bioRxiv - Physiology 2023Quote: ... Protein samples were suspended in Laemmli Sample Buffer supplemented with 2-Mercaptoethanol (β-mercaptoethanol) (BioRad Hercules, California – USA). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed using the Promega 2-step kit on a CFX96 Real-Time PCR System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated to 50°C for 2 min before addition of 40 µl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 ug RNA was used to synthesize cDNA with the iScript™ cDNA Synthesis Kit (Bio-Rad 1708890). The SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad 1725271 ...
-
bioRxiv - Physiology 2023Quote: ... and samples of four larvae each were homogenized in 100 μl 2× SDS sample buffer (Bio-Rad #1610737) containing 5% (355 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Three hundred micrograms of protein was precipitated using a ReadyPrep 2-D Cleanup Kit (Bio-Rad Laboratories, USA) at −20 °C overnight ...
-
bioRxiv - Immunology 2023Quote: ... unreacted ITC-DTPA was removed by dialysis against 0.25 M ammonium acetate (NH4Ac) pH 5.4–5.5 (metal free) supplemented with 2 g/L Chelex (Bio-Rad) using 20,000 molecular weight cut-off dialysis cassettes (Slide-a-Lyzer ...
-
bioRxiv - Biochemistry 2023Quote: ... The detergent was removed by three 2-hour incubations with ∼33 mg of Bio-Beads SM2 (Bio-Rad) followed by overnight incubation with ∼50 mg of Bio-Beads SM2 with all incubations occurring at 4°C.
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized from total RNA (1-2 μg) with iScript Advanced cDNA Synthesis Kit (Bio-Rad; 1725038). Quantitative RT-PCR (qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using 2 μg of total RNA and the iScript cRNA synthesis kit (Bio-Rad). qPCR was performed using the Brilliant III ultra-Fast SYBR green qPCR master mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were added with equal volume of 2× Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA, USA) containing 65.8 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was then cleaned 2-times on Micro Bio-Spin™ P-6 gel Columns (BioRad, #732-6221) where buffer was exchanged with phase separation buffer ...
-
bioRxiv - Genomics 2023Quote: ... proteins were transferred (80 V; 2 h; 4°C) onto a 0.2 µm nitrocellulose membrane (Bio-Rad 1620112). Membranes were air-dried ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was passed twice on 2 x Mini CHT ™ type I column (Bio-Rad, United States). Elution was performed with a gradient of 0 to 200 mM NaPO42- in 10 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was transferred to an ice-cold 2 mm gap electroporation cuvette (Bio-Rad Laboratories GmbH, Germany), and cells were electroporated with a single pulse at 1.8 kV ...
-
bioRxiv - Genomics 2023Quote: ... Gene panel probe hybridization occurred overnight for 18 hours at 50°C (Bio-Rad DNA Engine Tetrad 2). Subsequent washes the next day removed unbound probes ...
-
bioRxiv - Genetics 2023Quote: ... 1 ml 2xYNB with 2% glucose was added to the sorted cells in sheath fluid (PBS, BioRad #12012932) and they were transferred to a shaking incubator and grown at 30 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of total RNA was used for cDNA preparation using the iScript cDNA Synthesis Kit (Bio-Rad). A 1/10 dilution of the cDNA was then used for qRT-PCR analysis utilizing the SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... were harvested and resuspended in 1X PBS-NaN3 (0.2%) and embedded in 2% low-melt agarose (Mb grade, BioRad). Agarose plugs were chilled at 4°C for 30 min and then ejected into Proteinase K digestion buffer (1 mg/mL proteinase K ...
-
bioRxiv - Biophysics 2022Quote: ... Nanodisc reconstitution was induced by removing detergent with 0.8 mg ml-1 pre-washed Biobeads SM-2 (Bio-Rad) for 2 hours with gentle agitation at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated in 2-mm cuvettes (600 V, 50 μF, 200 Ω) by using Gene Pulser Xcell (Biorad). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... resolved by size on a 2% agarose gel and imaged on Gel Doc XR+ and ChemiDoc XRS+ systems (Biorad).
-
bioRxiv - Cell Biology 2022Quote: ... The reaction mixture (total volume 22 μl) contained 11 μl of 2× ddPCR Super Mix for Probes (BioRad, 1863024), 1.1 μl of 4 primers mixture 18 μM each ...
-
bioRxiv - Pathology 2019Quote: ... by SDS-PAGE at 100 V for 2 hours in a Mini-PROTEAN® Tetra cell apparatus (Bio-Rad). The Kaleidoscope commercial standard Precision Plus Protein Standard (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse Transcription cDNA synthesis reactions were performed on 0.2 μg −2 μg total RNA with iScript cDNA synthesis kit (BioRad) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... The cDNA was then diluted 10x with water and 2 µl was mixed with iQ SYBR Green Supermix (BioRad) containing 100 nM of forward and reverse primers ...
-
bioRxiv - Genetics 2020Quote: ... 2 mM ATP and 1 mM DTT and the reactions were stopped by addition of Laemli sample buffer (BioRad). Samples were run on precast 4-20% gradient SDS-PAGE gels (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed in 20 μL reactions in triplicate containing 10 μL 2 × SsoFast EvaGreen Supermix (Bio-Rad,), 1 μL of primers (3 μM F and 3 μM R) ...
-
bioRxiv - Microbiology 2021Quote: ... the plates were sealed and incubated at 37°C for 2 h in a T100 Thermal Cycler (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: Resuspended purified beta-propiolactone treated SARS-CoV-2 virus preps were separated by SDS-PAGE (Bio-Rad TGX Mini) and transferred to 0.2 µM PVDF membrane according to the manufacturer’s protocols (Bio-Rad Tansblot Turbo) ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysates from SARS-CoV-2 infected Vero E6 cells were harvested in 2x Laemmli sample buffer (Bio-Rad) containing 2-Mercaptoethanol (Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 150 mM KCl and 2 mM MgCl2) at 37°C for 16 hours in thermal cycler (Bio-Rad, USA). The samples were separated using 10% non-denaturing polyacrylamide gel and tris/boric acid/EDTA buffer (TBE ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were run on 2% agarose gel and visualized in a Gel Doc EZ System (Bio-Rad, USA). GAPDH served as an endogenous control.
-
bioRxiv - Biochemistry 2021Quote: ... The protein was incubated at 4°C for 1 h with Bio-Beads™ SM-2 resin (Bio-Rad) equilibrated with 100 mM Tris-HCl ...