Labshake search
Citations for Bio-Rad :
101 - 150 of 9002 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins (5 μg) were separated on a 4–15 % polyacrylamide gradient gel (Bio-Rad) and then transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Physiology 2019Quote: ... and blocked for 24 hours at 4°C in 5% blotting-grade blocker (BioRad). Blots were incubated in primary OXPHOS antibody (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Microbiology 2022Quote: ... the indicated ESA supernatant was boiled in SDS-PAGE sample buffer and 3 μg of each sample was run with a 4-15% TGX gradient gel (Bio-Rad cat. no. 4561086), then transferred to a nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were diluted 1:4 with Laemmli sample buffer (Bio-Rad), incubated for 95°C (5min) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates (30 µg) were run approximately one inch into a 4-15% bis-acrylamide gel (Bio-Rad) and processed for in-gel digestion as previously described (60) ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Immunology 2022Quote: ... for 2 hours at 4 °C using Mini-trans blot wet tank transfer (BioRad). After transfer ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was incubated at 4°C for 1 h with Bio-Beads™ SM-2 resin (Bio-Rad) equilibrated with 100 mM Tris-HCl ...
-
bioRxiv - Microbiology 2023Quote: ... Tissues were rinsed in DBPS and moved to semi-solid media (6:4 ratio of 1% agarose (BIO-RAD, Hercules, CA, USA) in DPBS:DMEM with 10% FBS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Immunology 2022Quote: ... incubated for five days at 4°C in 40 mL of hydrogel monomer solution [4% acrylamide (Bio-Rad), 0.05% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...
-
bioRxiv - Molecular Biology 2023Quote: ... Table 1) was performed at 4°C overnight at a 1:1000 dilution in 5% nonfat dry milk (Bio-Rad No. 1706404). Incubation of HRP conjugated secondary antibody (different species ...
-
bioRxiv - Bioengineering 2019Quote: ... Then 5-10ug protein per sample was loaded onto 4%-20% gradient gel (Bio-rad) and the gel was run for 2 hours at 90mV ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-15% Mini Protean gels (BioRad). Proteins were transferred to nitrocellulose membrane using Turbo-blotter (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 4% goat (Bio-Rad Laboratories, #C07SA) or donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2020Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (DY485 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4-15% (BIO-RAD #456-1083) Mini PROTEAN® gel in Tris/Glycine/SDS (BIO-RAD #1610772) ...
-
bioRxiv - Neuroscience 2022Quote: Criterion TGX 4-15% (Bio-Rad 5671084) and Mini-Protean TGX precast gels (Bio-Rad 4561083 ...
-
bioRxiv - Molecular Biology 2021Quote: 4-20% precast SDS PAGE gels (BioRad) were used for electrophoretic separation of immuno purified samples ...
-
bioRxiv - Immunology 2021Quote: ... 4-15% gradient gels (Bio-Rad 4561086) and transferred to PVDF membranes (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... run on 4-20 % polyacrylamide gels (BioRad) according to manufacturer’s instructions and analyzed by adding InstantBlue (Expedeon).
-
bioRxiv - Microbiology 2019Quote: ... loaded on 4-20% polyacrylamide gels (BioRad), and transferred to Immobilon-P Transfer Membranes (Millipore Corp) ...
-
bioRxiv - Genetics 2021Quote: ... 4% (wt/vol) acrylamide (Bio-Rad, USA), 0.05% (wt/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... 4% w/v acrylamide (Bio-Rad 1610140), 0.05% w/v bis-acrylamide (Bio-Rad 1610142) ...
-
bioRxiv - Plant Biology 2020Quote: ... in 4-mm electroporation cuvettes (Bio-Rad) with the following setting ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad, Hercules, California), and in the case of immunoblot analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... separated in 4-20% SDS–PAGE (BioRad) and electroblotted to nitrocellulose membrane ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 4-20% TGX (Bio-Rad, 4561096) for visualization of auto- ubiquitylation or substrate ubiquitylation ...
-
bioRxiv - Bioengineering 2022Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (430104 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 mm gap (Bio-Rad, Hercules, CA) containing 20 µg pCas-Ov-grn-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... separated by 4-15% SDS-PAGE (BioRad), transferred and treated with a polyclonal rabbit anti-TDP-43 antibody (ProteinTech ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4-20% Tris-glycine gel (BioRad) and blotted on a PVDF membrane (BioRad) ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Neuroscience 2021Quote: ... A 1:5 dilution from serum samples was combined with 4 °C Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA) and heated at 100 °C for 10 min before loading into 12% Mini-PROTEAN TGX Stain-Free gels (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... Purified TREK-2 was then mixed with GUVs to a final concentration of ∼1 - 5 µg/ml and incubated overnight at 4 °C with 0.5mg/ml Bio-Beads (Bio-Rad) prior to use.
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was diluted 1:4 and 4.3 µL of cDNA was mixed with 5 µL iTaq Universal SYBR Green Supermix (BioRad 1725124) and 0.7 µL of 5 µM forward and reverse qPCR primers targeting the gene of interest (333 nM final primer concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were electrophoresed at 150V for one hour through 7.5% or 4-20% mini-PROTEAN TGX gels (Bio-Rad) and blotted at 300 mA for one hour onto PVDF membranes ...
-
bioRxiv - Neuroscience 2021Quote: ... with primers listed in Table 4-1 on a CFX96 system (BioRad). Thermocycler conditions were 95°C for 3 min followed by 40 cycles of 95°C for 10 sec and 55°C for 30 sec ...
-
bioRxiv - Cancer Biology 2022Quote: ... was added to a 1:4 mixture of Laemmli Sample Buffer (BioRad) and 2- Mercaptoethanol (BioRad ...
-
bioRxiv - Molecular Biology 2021Quote: Purified SARS-CoV-2 N protein was electrophoresed on 4-10% SDS-PAGE (Bio-Rad) and stained with Coomassie Brilliant Blue G-250 (CBBG-250) ...
-
bioRxiv - Plant Biology 2021Quote: ... At least 4-6 technical replicate RT-qPCR reactions were performed using iTAQ with ROX and SYBR (BioRad), and 20μL reactions were prepared as per the manufacturer recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 µg of protein was separated by SDS-PAGE using pre-cast TGX 4-15% gradient gels (BioRad). Protein was transferred to a 0.45 µm nitrocellulose membrane ...