Labshake search
Citations for Bio-Rad :
51 - 100 of 4928 citations for 6H Purin 6 one 1 2 3 9 tetrahydro 3 methyl 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-Drosophila AMPK1/2 (BioRad, 1:1000), rabbit anti-diphosphorylated ERK (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... ERK1/2 (1:1000, Bio-Rad Cat# MCA4695T), horseradish peroxidase-conjugated anti-rabbit (1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... were seeded per well in 6-well plates (2 ml per well). 24 hrs later cells were transfected with siRNA (Supp. Table 9) using SilentFect (Bio-Rad) in biological triplicates ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Genetics 2019Quote: ... the size of the amplicon was determined by comparison with a 2-kb DNA marker with the use of Quantity One software (version 4.6.7; Biorad), and the number of repetitions was estimated by comparing the size of the product amplified from the Nichols strain ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-tubulin YL1/2 (dilution 1:50; Biorad) and guinea-pig anti-Ana1 (dilution 1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2022Quote: ... Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Immunology 2022Quote: ... samples were mixed 1:1 with 2 x native sample buffer (BioRad) and loaded on a 4-20% precast protein gel (BioRad ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Biochemistry 2021Quote: KirBac3.1 protein was buffer-exchanged to 200 mM ammonium acetate (pH=8.0) with 0.5% C8E4 (2×CMC) using a Biospin-6 column (BioRad). The protein sample was loaded into a gold coated needle prepared in-house and analysed on a modified Q-Exactive mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was then cleaned 2-times on Micro Bio-Spin™ P-6 gel Columns (BioRad, #732-6221) where buffer was exchanged with phase separation buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... 25 mg ml−1 Bio-Beads SM-2 (Bio-Rad) was added and incubated at 4°C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... diluted 2:1 in 4X Laemmli sample buffer (Bio-Rad) containing 100 mM Dithiothreitol (CAS No ...
-
bioRxiv - Microbiology 2022Quote: ... Capacitors were 1-cm Tygon tubing (2 mm ID, BioRad), having Luer connectors on each extremity ...
-
bioRxiv - Microbiology 2023Quote: ... and β-tubulin (clone YL1/2, Bio-Rad; 1:5000) antibodies at 4°C overnight ...
-
bioRxiv - Biophysics 2020Quote: ... using a 9 × 9 mm2 frame seal (SLF0201, Biorad). The chamber was plasma-treated to improve wettability ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We used 1 μL diluted cDNA (1:3 in ddH2O) and iTaq Universal SYBR Green Supermix (Bio-rad) in the Bio-rad CFX96 real-time PCR detection system for qPCR experiments ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Biophysics 2022Quote: ... 1 mg of post-thrombin digested claudin-4 in DDM was treated with 4 mg of amphipol (1:4 w/w) for 2 hours before removing detergent via addition of 400 mg SM-2 biobeads (Bio-Rad). Excess cCpE was added to each claudin-4 sample at a molar ratio of 1:1.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mixtures contained 100 ng RNA template per sample diluted 2-fold with qPCR solution (iTaq Universal SYBR Green One-Step Kit, Bio-Rad) containing the primers D2S and D2C ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was isolated from 6-week-old rosette leaves and bolting flower buds of Col-0 and one of the RPF2-atp1 (RPF2-atp1-9) transformed lines (T3) with PureZol reagent (BioRad). Three independent libraries for each genotype were made from total RNA treated with 250 ng of Turbo DNase (Ambion ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules, CA) were then secured to a coverslip ...
-
bioRxiv - Biophysics 2022Quote: ... Frame-seal slide chambers (9 × 9 mm, Bio-rad, USA) were affixed to the glass coverslips ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...