Labshake search
Citations for Bio-Rad :
151 - 200 of 7826 citations for 6H Imidazo 4 5 1 ij quinolin 6 one 4 5 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and were heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (Bio-Rad, 4–15% Tris/Glycine) and then transferred onto 0.2 µm nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: The protein band intensities/areas from immunoblots were quantitated using ImageJ v1.4 software (National Institute of Health, MD; http://rsb.info.nih.gov/ij/) or ImageLab software (Bio-Rad) and mean fold changes in protein levels and percentage protein bound were calculated in Microsoft Excel for Mac 2011 (Microsoft Corporation) ...
-
bioRxiv - Plant Biology 2021Quote: ... At least 4-6 technical replicate RT-qPCR reactions were performed using iTAQ with ROX and SYBR (BioRad), and 20μL reactions were prepared as per the manufacturer recommendations ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Plant Biology 2019Quote: ... 5- to 6-week-old expanded leaves of Arabidopsis plants were bombarded with 1nm gold particles (BioRad) coated with pB7WG2.0-GFP and pB7WG2.0-RFPER ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed with TBST (6 × 5 min) and developed using Clarity Western ECL Substrate (Bio-Rad, California, US). Images were captured with ChemiDoc XRS+ system (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Biochemistry 2021Quote: ... Beads were incubated 5 min at 95 °C in this solution and 20 µL of supernatant was analyzed on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins were detected with an infrared imager (Odyssey ...
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... 4 μl of the eluate was analyzed by 4-20% SDS PAGE (Biorad) and silver staining ...
-
bioRxiv - Biophysics 2023Quote: ... This mixture was then incubated at 4 °C for 1 hour and further subjected to a 4-hour incubation with bio-beads (Bio-Rad, USA). After incubation ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were diluted 1:4 with Laemmli sample buffer (Bio-Rad), incubated for 95°C (5min) ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were incubated overnight at 4 °C with rabbit anti-chick IL-6 (Bio-Rad Laboratories, Inc., Hercules, CA) diluted 1:20 in incubation buffer ...
-
bioRxiv - Physiology 2024Quote: ... 6 μg of protein from each sample was loaded into a 4-20% Mini-PROTEAN® TGX gel (BioRad) and proteins were separated by size using electrophoresis ...
-
bioRxiv - Neuroscience 2022Quote: ... then washed 6 x 5 minutes with TBS-T before developing with Clarity Western ECL Substrate (Bio-rad).
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2019Quote: ... 4-20% gradient gels (BioRad) and transferred to 0.2 μm nitrocellulose membranes (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Microbiology 2023Quote: ... 4% low-melt agarose (BioRad) was prepared in 100 mM sodium cacodylate buffer and kept liquid at 70 °C until needed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL diluted cDNA (5 ng) in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each experimental sample (four source colonies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were boiled at 95 °C for 10 mins with 6×SDS sample buffer before loading onto 4–20% Tris-glycine gels (BioRad). Resolved proteins were transferred to nitrocellulose membranes using the Trans-Blot® Turbo system (BioRad ...
-
bioRxiv - Systems Biology 2021Quote: ... and 6 μl for slow growing mutants with lower OD600) on Stain-Free gels (4-20%, CAT # 4568096, Bio-Rad, Tris/Glycine SDS Buffer (CAT # 161-0732 ...
-
bioRxiv - Neuroscience 2021Quote: ... with primers listed in Table 4-1 on a CFX96 system (BioRad). Thermocycler conditions were 95°C for 3 min followed by 40 cycles of 95°C for 10 sec and 55°C for 30 sec ...
-
bioRxiv - Cancer Biology 2022Quote: ... was added to a 1:4 mixture of Laemmli Sample Buffer (BioRad) and 2- Mercaptoethanol (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... and densitometric analysis was performed using the Gel Doc 2000 Gel Documentation System and Quantity One version 4 software (BioRad, CA, USA). The β-tubulin signal was used to normalize protein levels.
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were biolistically transfected after 5-6 days in vitro using a Helios Gene Gun (120 psi; Bio-Rad) with pLenti-hSyn-eNpHR3.0-EYFP (eNpHR3.0 fused to EYFP and driven by the human synapsin I promoter ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were mixed with Bradford reagent (1:5; Bio-Rad) and absorbance was measured at 595 nm ...
-
bioRxiv - Molecular Biology 2024Quote: ... were used at 1:5000 in 5% Blotting-Grade Blocker (BioRad).
-
bioRxiv - Plant Biology 2020Quote: ... we used 2 µl of a 1/5 dilution of the cDNA obtained as above in a reaction containing 5 µl of SsoFast EvaGreen (Bio-Rad, USA), 0.5 µl of Forward primer (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Cell Biology 2020Quote: ... Densitometric band analysis was performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA; https://imagej.nih.gov/ij/) and Image Lab software (Bio-Rad, UK).
-
bioRxiv - Molecular Biology 2020Quote: ... IB analysis was performed after 6-7.5% SDS-PAGE or 4-20% Mini-PROTEAN TGX Precast Protein Gels (BioRad, Hercules, CA), with overnight incubation with a 1:1000 dilution of primary antibody and followed by a 1:5000 dilution of horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2019Quote: ... 4 µl of the diluted DNA sample was added to 6 µl of a mixture containing SYBR Green Supermix (Bio-Rad) and gene-specific primers (0·4 µM total ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...