Labshake search
Citations for Bio-Rad :
201 - 250 of 4900 citations for 6H Furo 3 2 d 1 3 dioxin 6 one 4a ethoxytetrahydro 2 2 dimethyl 4aR 7aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... cells were infected with SINV at an MOI of 2 and pictures were taken 6 hours post-infection using ZOE fluorescent cell imager (Bio-Rad). Proteins were collected with lysis buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% (w/v) SDS and 6% (v/v) β-mercaptoethanol) and protein concentrations were quantified using Bradford Protein Assay (Bio-Rad). Equal concentrations of protein were fractionated on NuPAGE 4-12% Bis-Tris Protein Gels ...
-
bioRxiv - Biochemistry 2021Quote: ... was incubated at 55°C for 2 h and then purified by 6% non-denaturing PAGE using a Prep Cell apparatus (Bio-Rad).
-
Targeting MOG to skin macrophages prevents EAE in macaques through TGFβ-induced peripheral tolerancebioRxiv - Immunology 2019Quote: ... TGFβ2 and TGFβ3), as 2 separate dosages, following supplier (Merckmillipore, Burlington, MA, USA) guidelines using a Bioplex 200 (BioRad, Hercules, CA, USA). The quantification of all samples was performed all together.
-
bioRxiv - Bioengineering 2022Quote: ... pH 8.3 at 100 V for 2 h at 2-8 °C using PowerPac Basic setup (Bio-Rad Laboratories Inc., Hercules, CA). Post-electrophoresis ...
-
bioRxiv - Plant Biology 2019Quote: ... Bio-Beads SM-2 absorbents (152-8920, Bio-Rad) that had been washed in methanol (3 x 10 min) ...
-
bioRxiv - Biophysics 2021Quote: ... 1.5 ml of BioBeads SM-2 slurry (Bio-Rad) was added to remove the detergents ...
-
bioRxiv - Biophysics 2021Quote: ... After several incubation rounds with biobeads SM-2 (Biorad), the proteoliposomes were harvested the next day ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 million N2A cells were transfected using TransFectin (Biorad) with either CFP-ctrl. ...
-
bioRxiv - Immunology 2019Quote: ... Fixed HEp-2-coated microscope slides (Kallestad®, BioRad) were blocked ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were run on an Optocon 2 thermocyler (Biorad). Primers used are listed in Table 2.
-
bioRxiv - Biophysics 2021Quote: ... 37.5 μl 2% Bis-solution (161-0142, Bio-Rad), 2 μl (0.4% ...
-
bioRxiv - Bioengineering 2021Quote: ... Synthetic SARS-CoV-2 RNA was purchased from BIORAD (SARS-CoV-2 Standard #COV019 and SARS-CoV-2 Negative #COV000).
-
bioRxiv - Biochemistry 2020Quote: ... followed by 4 incubations with BioBeads SM-2 (BioRad) to remove the detergent ...
-
bioRxiv - Cancer Biology 2020Quote: ... and supplemented with 5% 2-mercaptoethanol (Bio-Rad Laboratories) for 8 minutes at 100 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... treated with 2 X Laemmli sample buffer (Bio-Rad) to elute/denature protein before SDS-PAGE and immunoblotting for DAT as above ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 μl 2× ddPCR Supermix for probes (Bio-Rad), 1.25 μl R636S+SM FAM probe and primer premixture ...
-
bioRxiv - Biophysics 2020Quote: ... An equal volume of Biobeads SM-2 (Bio-Rad) was added to the nanodisc mixture for detergent removal ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laemmli sample buffer (Bio-Rad #1610747, 5% 2-mercaptoethanol) was added to 20 µg protein and samples were boiled at 95°C for 5 minutes before being loaded onto a 10% SDS-polyacrylamide gel (Bio-Rad #4568034) ...
-
bioRxiv - Molecular Biology 2022Quote: ... in a 2 mm Gene Pulser cuvette (Bio-Rad) and was subjected to electroporation at 2.3 kV ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 100 mM 2-Mercaptoethanol (Bio-Rad Cat#1610710), and nucleosides (Millipore Cat#ES-008-D).
-
bioRxiv - Molecular Biology 2020Quote: ... 2) Chelex 100 Resin (Bio-Rad, Hercules, CA, USA); and 3 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 M thiourea and 65 mM dithiothreitol (BIORAD, Australia). Isoelectric focusing (IEF ...
-
bioRxiv - Genomics 2020Quote: ... 2% bis-acrylamide aqueous solution (Bio-Rad Laboratories, 1610142), 97% sodium acrylate powder (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... Detergent was removed with SM-2 Bio-Beads (BioRad) at a ratio of 30:1 beads:detergent (wt wt- 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total ERK1/2 (BioRad, USA, 171V60003M), Bio-Plex Pro Total GSK-3β (BioRad ...
-
bioRxiv - Cell Biology 2020Quote: ... YL1/2 rat anti-α-tubulin (MCA77G, Bio-Rad) was used as a primary antibody ...
-
bioRxiv - Biophysics 2021Quote: ... bis-acrylamide crosslinker (Bio-Rad, 2% Bis Solution, 1610142), and deionized water were mixed at appropriate concentrations (see Table 1 in Ref.37 for the compositions of 3T1C and 3T2C gels) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mL of 10% ammonium persulfate (APS, Bio-Rad) and 70 μL of tetramethylethylenediamine (TEMED ...
-
bioRxiv - Biophysics 2022Quote: ... followed by Bio-beads SM-2 Resin (Bio-Rad) for the removal of DDM overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 2 % (w/v) Blocking-Grade Blocker (BIO-RAD) at room temp for 1 h and then incubated with primary antibody at 4°C overnight ...
-
bioRxiv - Biophysics 2022Quote: ... 400 mg of wet Bio-Beads SM-2 (BioRad) per 500 μL of mixture was added and the mixture continued to incubate overnight to remove detergents ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 10% (v/v) 2-mercaptoethanol (Bio-Rad 1610710) was combined 1:3 with the prepared protein and then incubated at 95°C for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 125 mg of Bio-Beads SM-2 (Bio-Rad) (prewashed with methanol ...
-
bioRxiv - Biophysics 2022Quote: ... After several incubation steps with biobeads SM-2 (Biorad), the proteoliposomes were harvested the next day ...
-
bioRxiv - Plant Biology 2023Quote: ... The reaction mixture containing 2× ddPCR Supermix (Bio-Rad), 0.8 μM primer ...
-
bioRxiv - Biophysics 2022Quote: ... 400 mg of wet Bio-Beads SM-2 (BioRad) per 500 μL of mixture was added and the mixture continued to incubate overnight to remove detergents ...
-
bioRxiv - Microbiology 2023Quote: ... containing 2 mL settled Ni-NTA resin (Bio-Rad) pre-equilibrated with wash buffer (20 mM HEPES ...
-
bioRxiv - Cell Biology 2024Quote: ... 10% glycerol) and eluted in 2× loading buffer (Biorad) with β-mercaptoethanol by boiling for 5 min at 95°C.
-
bioRxiv - Cell Biology 2022Quote: ... Band densitometry analysis was performed using Quantity One 1-D Analysis Software (Bio-Rad). To normalize across different gels and to encompass all 3 ages and genotypes ...
-
bioRxiv - Neuroscience 2024Quote: ... the concentration of the resultant solution containing labelled αSyn was adjusted to 2 mg/mL and excess unbound dye was removed using Bio-Spin 6 size exclusion spin columns (Bio-Rad Laboratories). ATT565-αSyn was added to LUHMES cells on day six in vitro at a final concentration of 2 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... or anti-rat Ly-6B.2 alloantigen (1:100, MCA771GA, Bio-Rad Laboratories, Hercules, CA) for neutrophils ...
-
bioRxiv - Neuroscience 2020Quote: ... TBS-T) before incubation with HRP-conjugated secondary antibody for 2 hours (Biorad, 1:1000). After 3 times washes with 5 min intervals with TBS-T ...
-
Bacterial Polyphosphates Induce CXCL4 and Synergize with Complement Anaphylatoxin C5a in Lung InjurybioRxiv - Immunology 2022Quote: ... using 1-2 ng cDNA per sample complemented with iQ SYBR®Green Mastermix (BioRad) and specific forward and reverse primers at a concentration of 0.5 µM each ...
-
bioRxiv - Cell Biology 2019Quote: ... Perifusion fractions were collected at 2-minute intervals following a 20-minute equilibration period in 2 mM glucose using a fraction collector (Bio-Rad, Model 2110) and analyzed for insulin and glucagon concentration by RIA (insulin –RI-13K ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Biochemistry 2021Quote: ... The purified proteins were running in 2-D gel electrophoresis and images were taken and analyzed in gel dock(Bio-Rad, USA). The details of protein purification protocols like TCA/Acetone ...
-
bioRxiv - Microbiology 2019Quote: ... and FLAG-cMCF-HA recovered as described above were prepped using the Bio-Rad ReadyPrep 2-D Cleanup Kit (Bio-Rad 1632130). The sample was then loaded onto 11 cm pH 3-10 immobilized pH gradient (IPG ...