Labshake search
Citations for Bio-Rad :
401 - 450 of 10000+ citations for 6H Benzo g 1 4 diazonino 7 6 5 cd indol 6 one 10 ethenyl 1 3 4 5 7 8 10 11 12 13 decahydro 4 hydroxymethyl 8 10 13 trimethyl 7 13 bis 1 methylethyl 4S 4R* 7R* 10S* 13S* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Blue Native PAGE gel experiments were performed in a cold room (4 °C) using 10% precast gels (BioRad Mini-PROTEAN) and run at 170 V for 55 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... cuvette gap width 0.4 cm) with 10 µg of in vitro transcribed HCV full-length RNA using the Gene Pulser Xcell system (BioRad). Cells of two electroporations were combined in 20 ml of DMEM complete and seeded into one 15 cm dish ...
-
bioRxiv - Microbiology 2024Quote: ... Blots were washed 4 × 10 min with TBST and then visualized by enhanced chemiluminescence using the Clarity Max (Bio-Rad) substrate.
-
bioRxiv - Molecular Biology 2024Quote: ... and heat denatured at 95°C for 10 min before loading onto a 4-15% Tris-glycine gel (Bio-Rad) and electrophoresed at 125 V ...
-
bioRxiv - Biochemistry 2024Quote: ... denatured for 10 min at 96°C before it was separated at a 4-20 % PROTEAN TGX stain-free gel (BioRad) at 200 V for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were subjected to 10% SDS-PAGE in 1× TGS (Bio-Rad) for one and half hour with current settings at 30 mA per gel ...
-
bioRxiv - Microbiology 2019Quote: ... The sample was then loaded onto 11 cm pH 3-10 immobilized pH gradient (IPG) strips (Bio-Rad 1632014) and rehydrated overnight ...
-
bioRxiv - Neuroscience 2021Quote: Samples were resolved by SDS-PAGE using either 10 or 12% acrylamide/bis-acrylamide gels and transferred to 0.22 µm nitrocellulose (Bio-Rad). Membranes were blocked with Odyssey blocking buffer (LI-COR Biosciences) ...
-
bioRxiv - Neuroscience 2024Quote: Samples were resolved by SDSPAGE using either 10 or 12% acrylamide/bis-acrylamide gels and transferred to 0.22 µm nitrocellulose (Bio-Rad). Membranes were blocked with Odyssey blocking buffer (LI-COR Biosciences ...
-
bioRxiv - Physiology 2023Quote: ... Standard SDS-PAGE was performed with BioRad 7-12% TGX gels (4561086; BioRad, Hercules, CA, USA) and polyvinylidine difluoride (PVDF ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10% (BioRad) and run for 1 hour at 150 volts ...
-
Genetically engineered microglia-like cells have therapeutic potential for neurodegenerative diseasebioRxiv - Neuroscience 2021Quote: ... Samples were loaded into precast 10% Bis-Tris polyacrylamide gels (Bio-Rad) with MOPS buffer (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... Samples were run on 10% Bis-Tris Criterion Gels (BioRad, Hercules, CA) and transferred to nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates (30 µg) were run approximately one inch into a 4-15% bis-acrylamide gel (Bio-Rad) and processed for in-gel digestion as previously described (60) ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... The DNA preparation involves coating 10 μl of .6 μm Gold microcarriers (1652262 Bio-Rad, Hercules, CA) with 1μg of purified DNA by gently vortexing DNA ...
-
bioRxiv - Biophysics 2023Quote: Proteins samples were kept on ice and buffer exchanged into 200 mM ammonium acetate buffer at pH 7 using Micro Bio-spin columns with either a 6 or 30 kDa cutoff (Bio-Rad, Hercules, CA). Buffer exchanged samples were then diluted to a working concentration of 10 μM before analysis ...
-
bioRxiv - Physiology 2022Quote: ... real-time quantitative polymerase chain reaction (RT-qPCR) was executed with 13 ng cDNA using SSO advanced SYBR Green supermix (Bio-Rad Laboratories, Hercules, CA, USA) with the following settings ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were separated on 12% SDS-polyacrylamide (29:1) or 4-15% precast polyacrylamide mini-gels (Bio-Rad) and electrotransferred on nitrocellulose membranes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Samples were then run on either 4-15% (a) or 8-16% (b) precast gels (Biorad), transferred onto 0.1μm nitrocellulose membranes and used for immunoblot detection ...
-
bioRxiv - Biophysics 2020Quote: ... samples were washed for two minutes with degassed polyacrylamide (PA) solution consisting of 4% (vol/vol) 19:1 acrylamide/bis-acrylamide (161010144, BioRad), 60 mM Tris-HCl pH 8 (AM9856 ...
-
bioRxiv - Biochemistry 2021Quote: ... The samples were then thawed and loaded onto 4-12% Criterion XT Bis-Tris precast gels (Bio-Rad), and run in 1x MOPS (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μg (volume equivalent) was resolved on a 4-12% Criterion XT Bis-Tris gel (Bio-Rad 3450124) at 100V for 2 hours ...
-
bioRxiv - Immunology 2022Quote: ... was from American Radiolabeled Chemicals and AG-1×8 resin was from BioRad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... separated on 4-12% SDS-polyacrylamide gel (Biorad), transferred onto nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: ... run on 4-12% Mini-Protean gels (BioRad), and rapid transferred to PVDF membranes ...
-
bioRxiv - Cell Biology 2022Quote: ... on Criterion 4–12% precast gels (Bio-Rad). Wells were loaded with the total eluent volume from the IP samples ...
-
bioRxiv - Systems Biology 2023Quote: ... separated on 4%-12% SDS-PAGE gels (BioRad), and transferred to PVDF membranes (Trans-blot turbo transfer system ...
-
bioRxiv - Genetics 2022Quote: ... 60 μg of protein was separated on 10% SDS/PAGE (Mini-PROTEAN TGX Gels,12%,10-well, 4561043, BIO-RAD) and transferred onto nitrocellulose membrane (#1620115 ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were assessed using 6% polyacrylamide gel (made with 29:1 Acrylamide/Bis Solution, Bio-Rad) electrophoresis ...
-
bioRxiv - Genetics 2023Quote: ... qPCR reactions (10 uL) contained 5 µl of SsoAdvanced Universal SYBR Green Supermix (BioRad), 2 µl H2O ...
-
bioRxiv - Genetics 2023Quote: qPCR reactions (10 µl) contained 5 µl of SsoAdvanced Universal SYBR Green Supermix (BioRad), 2 µl H2O ...
-
bioRxiv - Genetics 2023Quote: ... qPCR reactions (10 µl) contained 5 µl of SsoAdvanced Universal SYBR Green Supermix (BioRad), 1 µl H2O ...
-
bioRxiv - Genetics 2023Quote: ... qPCR reactions (10 μL) contained 5 μL of SsoAdvanced Universal SYBR Green Supermix (BioRad), 1 μL H2O ...
-
bioRxiv - Genetics 2021Quote: ... DNA was then diluted 1:100 and 1:10 and combined with QX200 ddPCR EvaGreen Supermix (BioRad) and custom-designed primers targeting either Slx/Slxl1 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was diluted between 1:10 and 1:20 for qPCR experiments and SsoFast EvaGreen Mastermix (Biorad) was used to amplify cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... was then added and the solution was mixed at 4°C for 10 minutes before addition of 100 mg of Biobeads SM2 (Bio-Rad). Biobeads were washed into methanol ...
-
bioRxiv - Neuroscience 2021Quote: 10-40 µg of denatured protein extracts were separated by SDS-PAGE using 10% acrylamide gels or 4-15% Mini-Protean precast gels (Bio-Rad) for 2 h at 120 V and transferred onto methanol-activated PVDF membranes at 350 mA for 2 h on ice ...
-
bioRxiv - Molecular Biology 2021Quote: Samples in 1x Laemmli loading buffer (generally equivalent to 1 µL replication reaction or chromatin recovered from 8 µL plasmid pull-down) were resolved on 10% or 4-15% acrylamide Mini-PROTEAN or Criterion TGX precast gels (Bio-Rad) and transferred to PVDF membranes (Perkin Elmer) ...
-
bioRxiv - Neuroscience 2019Quote: ... 30 μg of protein was heated in a 70°C water bath for 10 min prior to loading into into a 4-15% CriterionTM TGXTM precast Midi protein gel (Bio-Rad) for SDS-PAGE followed by wet transfer to nitrocellulose membrane ...
-
bioRxiv - Bioengineering 2020Quote: ... Equal amounts of protein lysates (10-20 μg total protein) were subjected to 4–20% SDS-PAGE (Bio-Rad, Hercules, CA). Western analysis was carried out with primary antibodies against phosphorylated Smad1/5 (p-Smad1/5) ...
-
bioRxiv - Biophysics 2020Quote: ... Inputs (2 μl) and elutions (10 μl) samples were analyzed by 4-15% SDS-PAGE (MINI-PROTEAN TGX stain-free, Bio-Rad) and staining with Quick Coomassie (Generon ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were washed and boiled in sample buffer and resolved on 10% SDS-PAGE or gradient gels (4 – 20%, Bio-Rad) and electro-transferred to PDVF membrane ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal amount of proteins from each lysate were subjected to polyacrylamide gel (4-10 %) electrophoresis (PAGE) in Mini-PROTEAN Tetra cell apparatus (Bio-Rad). PAGE separated proteins were blotted onto a PVDF membrane in a semi-dry Trans-Blot Turbo transfer system (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... SDS-Page was performed to resolve protein by molecular weight using 10 micrograms of hippocampal lysate from each sample in 4-20% acrylamide pre-cast gels (Biorad, 4568094). Resolved protein was transferred to PVDF membrane and blocked with 5% BSA solution in PBST ...
-
bioRxiv - Microbiology 2021Quote: The eluted IP samples were separated by molecular weight using SDS-PAGE (precast 4-20% Mini-PROTEAN TGX Stain-Free Protein Gels, 10 well, 50 μl; Bio-Rad) at 160 V for 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... samples were boiled for 10 minutes and loaded on 4–20% Mini-PROTEAN TGX gradient gels (Bio-Rad Laboratories, Hercules, CA).
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μg of proteins were then separated on a 4-15% Mini-PROTEAN TGX Stain-Free Gel (Bio-Rad, Ref: 4568085) at 160V ...