Labshake search
Citations for Bio-Rad :
251 - 300 of 1397 citations for 6 ethoxy N methylbenzothiazol 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Molecular Biology 2020Quote: The DNA was denatured using 0.5 M NaOH and 1.5 M NaCl and equal amounts were loaded onto a Hybond N + nitrocellulose membrane (GE Biosciences) using the Bio-Dot apparatus (Bio-Rad). Membranes were washed once with denaturing buffer and wash buffer (3× SSC) ...
-
bioRxiv - Developmental Biology 2022Quote: ... GEM-RT was performed in a C1000 Touch Thermal cycler with 96-Deep Well Reaction Module (Bio-Rad; P/N 1851197): 53°C for 45 min ...
-
bioRxiv - Bioengineering 2019Quote: Proliferation of MSCs was evaluated by determining the total cell count per well (n=3 wells/treatment/time-point) using a TC20 Automated Cell Counter (Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... The reaction was stopped using glacial acetic acid and the N-glycans desalted sequentially using strong cation exchange (AG 50W X8, Bio-Rad), C18 and porous graphitised carbon (PGC ...
-
bioRxiv - Microbiology 2020Quote: ... The protein concentration of the supernatant was determined by Bradford measurement according to the manufacturer’s instructions (Bio-Rad, cat n° 5000006).
-
bioRxiv - Genomics 2021Quote: ... RNAs were then transferred to a nitrocellulose membrane (GE Amersham HybondTM-N+) using a wet transfer system (Trans-Blot cell, Bio-Rad) at 100 V for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resolved genomic DNA was then transferred to the positively charged nylon membranes (Hybond-N+, Amersham Pharmacia Biotech) using a model 785 vacuum blotter system (Bio-Rad). The Bar amplified fragment (Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries were eluted from the gel by freezing the gel pieces at −20°C for 30 min in Freeze ‘N Squeeze DNA gel extraction spin columns (Bio-Rad) and recovering the solution by immediate centrifugation of the columns at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... DNA/protein complexes were transferred to a Hybond-N+ positively charged nylon membrane (Amersham Pharmacia Biotech) using an electroblot transfer system (Bio-Rad) and cross-linked with short-wave UV light in a GS gene linker UV chamber (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... with 10 μg of plasmid DNA expressing LpAsp-GFP or LpCht-GFP as well as pTrex-n-eGFP using a Gene Pulser X cell electroporator (Bio-Rad) and cuvette (2 mm gap) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and A6p (Table S1) were run on agarose gels and purified using Freeze ‘N Squeeze DNA gel extraction spin columns (Bio-Rad). For manual sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... 12 % SDS-PA gels were fixed with fixation solution (40 % ethanol, 10 % acetic acid) o/n and stained in Flamingo fluorescent protein dye (Bio-Rad) for up to 6 h and imaged with the ChemiDoc (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The purified RNA was separate on a 1.2% agarose-formaldehyde denaturing gel and was then transferred to a nylon membrane (Hybond-N+, Cytvia) in 10X SSC buffer using a model 785 vacuum blotter (Bio-Rad). RNA was cross-linked to the membrane using an ultraviolet (UV ...
-
bioRxiv - Microbiology 2023Quote: ... targeting SARS-CoV-2 gRNA and N protein sgRNA were used for the quantification by RT-qPCR using iTaq Universal SYBER Green Supermix (Bio-Rad) and normalised to β-actin using 2-ΔΔCT.
-
bioRxiv - Microbiology 2024Quote: Total RNA was loaded onto 8 to 12% PAGE–7 M urea gels and transferred to Hybond-N+ (GE) membranes using a Trans-Blot Turbo Transfer system (Bio-Rad) in 1X TBE ...
-
bioRxiv - Biochemistry 2023Quote: ... to saturate the N-terminal metal binding site,10 prior to buffer exchange using a centrifugal buffere exchange device (Bio-Spin, Bio-Rad) into 200 mM ammonium acetate supplemented with 2 x CMC of C10E5 ...
-
bioRxiv - Biophysics 2021Quote: ... one aliquot of Amberlite XAD-2 (BioRad) was added and allowed to incubate for 1 hour ...
-
bioRxiv - Cell Biology 2019Quote: ... and 2% bis-acrylamide (Bis) (1610142, Biorad) which resulted in different modulus of the PA gels ...
-
bioRxiv - Cell Biology 2020Quote: ... Bio-Beads SM-2 Adsorbents from Biorad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 50 mg of Biobeads SM-2 (BioRad) were added to remove detergent and promote protein insertion into liposomes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... containing 2 g Chelex-100 resin (BioRad) to remove divalent metals ...
-
bioRxiv - Biophysics 2021Quote: ... and 2 μL β-mercaptoethanol (Bio-Rad) were added to 30 μL of sample ...
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad, Cat#161–0142) as described elsewhere 48 ...
-
bioRxiv - Biophysics 2021Quote: ... 200 mg of BioBeads (SM-2, BioRad) were added and the sample incubated for another 3 h at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 10% 2-Mercaptoethanol (Bio-Rad, #1610710) and were heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: Kallestad Hep-2 Complete Kit (Bio-rad) was used to detect ANA reactive fecal IgA following the kit instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Bio-Beads (SM-2 resin; Bio-Rad) were added to the lysis reaction and samples were incubated for 1 hour in a mini-shaker (PS-3D ...
-
bioRxiv - Plant Biology 2020Quote: ... freshly supplemented with 2-mercaptoethanol (Biorad #1610710), heated for 30 min at 37°C and loaded into a polyacrylamide gel (any kD™ precast protein gel ...
-
bioRxiv - Biophysics 2020Quote: ... +/- 2-Mercaptoethanol (βME) (Bio-Rad Cat# 1610710). NuPAGE© gels (4-12% - Thermo Fisher Scientific Cat# NP0321 ...