Labshake search
Citations for Bio-Rad :
151 - 200 of 3688 citations for 6 cyano 5 methoxy 12 methylindolo 2 3 a carbazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... 5% of the lysates were boiled with 2 x laemmli buffer (BIO-RAD, Hercules, CA, USA) and used as input ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein was separated on either a 4-12% or 12% Criterion XT Bis-Tris protein gel (Bio-Rad) with XT-MES buffer and transferred to polyvinylidene membranes using the Trans-Blot Turbo Transfer system (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... 12 µl sample was loaded into a 4-12% polyacrylamide TGX Stain-Free gel (Bio-Rad Cat. 4568086) and run for 1 h 15 min at 15mA per gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... the concentration of the resultant solution containing labelled αSyn was adjusted to 2 mg/mL and excess unbound dye was removed using Bio-Spin 6 size exclusion spin columns (Bio-Rad Laboratories). ATT565-αSyn was added to LUHMES cells on day six in vitro at a final concentration of 2 µM ...
-
bioRxiv - Physiology 2021Quote: ... separated on 12% acrylamide/bis (Bio-Rad) gels ...
-
bioRxiv - Microbiology 2021Quote: ... and loaded on 12% gels (Bio-Rad) for electrophoresis ...
-
bioRxiv - Biochemistry 2023Quote: ... or on an 12% SDS-PAGE (BioRad) at 20 μM concentration without added reducing agent in the loading buffer.
-
bioRxiv - Cell Biology 2023Quote: ... and 12% SDS Page Criterion gels (BioRad) were loaded 10 μl per sample prior to being run as described above ...
-
bioRxiv - Cell Biology 2023Quote: ... Precast 12% SDS Page Criterion gels (BioRad) were loaded based on the linear range of each antibody (20 μg for each antibody except for PHPR2 ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Microbiology 2019Quote: ... Relative fluorescence was measured at 5-minute intervals for 2 hours in a CFX96 system (Bio-Rad).
-
bioRxiv - Developmental Biology 2019Quote: ... 2 μl of gene-specific primer pair and 5 μl iTaq Universal SYBR Green Supermix (Bio-Rad). The relative transcript abundance of each gene (normalized to rpl4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μl cDNA (diluted 1:5) using a CFX384 real-time system qRT-PCR machine (BioRad). Primers were designed using Benchling and purchased from Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... Beads were incubated 5 min at 95 °C in this solution and 20 µL of supernatant was analyzed on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins were detected with an infrared imager (Odyssey ...
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse primer: 5’-GCAGAAGAAGCAGACACAGC-3’) were PCR amplified and monitored using a CFX96 Touch Real-Time PCR detection system (Bio-Rad). Relative expression of PHETA1 transcripts was normalized to the expression of POLR2A and analyzed using standard delta delta Ct method ...
-
bioRxiv - Microbiology 2020Quote: ... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... were incubated in TBS-T/milk for 45 min and washed 3 × 5 min with TBS-T before detecting using a Chemidoc imager (Bio-Rad). NearIR-conjugated secondary antibodies (LI-COR Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer (HN: 5% Blotting Grade Blocker, Bio-Rad cat ...
-
bioRxiv - Immunology 2022Quote: ... were amplified by PCR using 5’ and 3’ primers with overhangs containing T7 binding sites using iProof High-Fidelity Taq (Bio-Rad). PCR reaction products were run on an agarose gel to check for the correct amplicon ...
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were washed in 1X PBS with 0.1% Tween 3 times for 5 minutes each before scanning using the ChemiDoc™ MP Imaging System (Bio-Rad). Note ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times for 5 min with TBS and were subsequently incubated with Clarity Western ECL substrate working solution (Bio-Rad) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was developed with Clarity Max Western ECL Substrate (Bio-Rad) for 1 minute before imaging ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The membrane was washed 3 times with TBST for 5 min each and then the membrane was incubated with Clarity Western ECL Substrate (Bio-Rad) for 2 min before exposure to film and development in a darkroom.
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was developed with Clarity Max Western ECL Substrate (Bio-Rad) for 1 minute before imaging ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... The samples were separated on a 12% on a 12% gradient XT precast Criterion gel using XT-MOPS buffer (Biorad) using XT-MOPS buffer (Biorad ...
-
bioRxiv - Cell Biology 2023Quote: ... Purity was confirmed by loading 1.125 µg of protein on a 12-well 12% Mini-Protean TGX gel (Bio-Rad), performing SDS-PAGE electrophoresis and fixing the protein with 40% methanol ...
-
bioRxiv - Immunology 2021Quote: ... separated on 4-12% SDS-polyacrylamide gel (Biorad), transferred onto nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: ... run on 4-12% Mini-Protean gels (BioRad), and rapid transferred to PVDF membranes ...
-
bioRxiv - Plant Biology 2021Quote: ... and vitamin B-12 (Mr 1,350) (Bio-Rad).
-
bioRxiv - Genetics 2019Quote: ... After separation on a 12% polyacrylamide gel (Biorad), proteins were transferred on Immun-Blot polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cancer Biology 2019Quote: ... Samples were separated using 12% polyacrylamide gels (BioRad). Transfer was performed using the iBlot system (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... using 12% acrylamide pre-cast gels (Bio-Rad) and then transferred to polyvinylidene fluoride (PVDF ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-CD3 antibody (clone CD3-12; Bio-Rad), anti-GFAP (Z0334 ...
-
bioRxiv - Pathology 2019Quote: ... run on 12 % Bis/Tris gels (Bio-Rad), electrotransferred onto nitrocellulose membranes ...