Labshake search
Citations for Bio-Rad :
101 - 150 of 1832 citations for 6 chloro 9H 3 C methyl β D ribofuranosyl purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total β-Actin (BioRad, USA, 171V60001M) were used for quantification of total proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse β-actin-conjugated with DyLight800 (1:10000; Biorad). Alexafluor680-conjugated donkey anti-rabbit and DyLight800-conjugated donkey anti-mouse (both 1:10000 ...
-
bioRxiv - Biophysics 2024Quote: ... containing 20 mM MgCl2 and exposed to a thermal annealing ramp (65 °C, 15’; 58-53 °C, 1 h/°C; stored at 20 °C) in a Tetrad2 (Bio-Rad) thermocycler ...
-
bioRxiv - Neuroscience 2019Quote: ... were heated at 99 °C for 3 minutes and subjected to 4-20% gradient SDS-PAGE prior to transfer to nitrocellulose membranes (Bio-Rad Laboratories, Inc.). Membranes were then blocked for 1 hour with 5% (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were denatured at 95 °C for 3 minutes prior to loading onto a 16.5% Mini-PROTEAN® Tris-Tricine Gel (Biorad Cat. No. 4563066). Gels were transferred to a nitrocellulose membrane (Millipore Sigma Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mouse anti-β-actin (1:1000, Bio-Rad, MCA5775GA). Membranes were probed with fluorophore-conjugated anti-mouse or anti-rabbit secondary antibodies (1:10,000 ...
-
bioRxiv - Microbiology 2023Quote: ... and β-tubulin (clone YL1/2, Bio-Rad; 1:5000) antibodies at 4°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... before boiling with Laemmli Sample Buffer + β-mercaptoethanol (Bio-Rad). Samples were separated on a Mini-PROTEAN TGX 4%–20% Tris-Glycine gel (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... or β-actin rhodamine (Biorad,1:5000 in blocking buffer) at 4°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Bioengineering 2021Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 s at 180°C by using a plate sealer (BioRad PX-1; CA, USA) and maintained at 4°C during the LC-MS measurement ...
-
bioRxiv - Systems Biology 2021Quote: ... incubated 5 min at 65 °C and separated by 12% SDS-PAGE (65) in the Mini Protean 3 Apparatus (BioRad Laboratories, Hercules, CA, USA). The final concentration of proteins was 10 μg per lane ...
-
bioRxiv - Genetics 2022Quote: ... the membranes were washed 3 times for 10 min each with TBST buffer at 24 °C and visualized using enhanced chemiluminescence reagents (Bio-Rad Laboratories, CA, USA). The images were captured using Image Quant LAS 4000 (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2021Quote: ... and O’nyong yong virus (ONNV) were subjected to a thermal gradient treatment from 30 to 60 °C for 3 h with a thermocycler (Bio-Rad T100 Thermal Cycler), after which samples were immediately titrated on Vero cells ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 seconds at 180°C by using a plate sealer (BioRad PX-1; CA, USA) and maintained at 10°C during the LC-MS measurements ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 s at 180 °C using a plate sealer (PX-1; Bio-Rad, Hercules, CA, USA) and maintained at 10 °C during the LC-MS measurements ...
-
bioRxiv - Microbiology 2022Quote: ... 59.2°C and 60°C using PCR thermal cycler (Biorad) for 30 min before HA assay.
-
bioRxiv - Microbiology 2022Quote: ... 59.2°C and 60°C using PCR thermal cycler (Biorad) for 30 min or left at 4°C as control before HA assay.
-
bioRxiv - Microbiology 2022Quote: ... containing a final concentration of 5% β-mercaptoethanol (Bio-Rad #1610710). Cell lysates were then denatured at 95°C for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... The β-tubulin antibody was tagged with Rhodamine (Bio-Rad #12004166) and was imaged using Rhodamine channel in Chemidoc-MP as per manufacturer’s instruction.
-
bioRxiv - Microbiology 2023Quote: ... containing 2% β-mercaptoethanol (Bio-Rad, Hercules, CA, USA, Cat# 1610710) and incubated at 70°C for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... containing 2% β-mercaptoethanol (Bio-Rad, Hercules, CA, USA, Cat# 1610710) and incubated at 70°C for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2022Quote: ... pH 7.5 and 150 mM β-mercaptoethanol (161-0710 from Bio-Rad), sonicated and heated at 95°C for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... blots were incubated with primary antibodies (Monoclonal Mouse anti-β-Actin, BioRad, Cat ...
-
bioRxiv - Cell Biology 2022Quote: The following primary antibodies were used: anti-β-actin (#MCA5775GA, Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... The fluorescent anti-β-actin antibody Rhodamine came from Biorad (catalog #: 12004163). The rabbit polyclonal anti-calnexin (catalog # ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... diluted in 4X Laemmli sample buffer containing β-mercaptoethanol (Bio-Rad, France), and incubated at 95 °C for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... in addition to rhodamine anti-β-actin (1:5,000, Bio-Rad, 12004163) for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... with 2.5 % β-mercaptoethanol were separated on 4−20 % SDS-TGX (Biorad) gels and transferred to 0.45 μM nitrocellulose membranes (GE Healthcare Life Sciences ...
-
bioRxiv - Developmental Biology 2021Quote: 30µg of protein in 1x sample loading dye with β-mercaptoethanol (BioRad) was boiled at 95⁰C for 5 minutes prior to electrophoresis on a 4-20% gradient SDS-PAGE gel (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... The fluorescent anti-β-actin antibody Rhodamine came from Biorad (catalog #: 12004163). The mouse monoclonal anti-Grp78 (BiP ...
-
bioRxiv - Pathology 2023Quote: ... 1% P/S and 0.1% β-mercaptoethanol (Cat# 1610710, Bio-Rad, USA). Cells were then counted ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein from both fractions was incubated with β-mercapethanol (BioRad 161-0710) according to 4×Laemmli Sample Buffer (BioRad 161-0747 ...
-
bioRxiv - Biochemistry 2021Quote: ... Mixtures were heated to 90°C for 10 min and slowly cooled to 40°C (0.1°C / second) using a Dyad PCR machine (Bio-Rad).
-
bioRxiv - Biochemistry 2022Quote: ... Samples were heated from 10 °C to 95 °C (10 s at each 0.5 °C step) using a CFX Connect qPCR (Bio-Rad). Melting temperatures were calculated with DSFWorld61 using model 1 in the “by sigmoid fitting” option ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Biochemistry 2022Quote: ... with a three-step protocol (95°C 15 sec, 60°C 30 sec, 68°C 60 sec) and iTaq Universal SYBR Green Supermix (Bio-Rad). Primer sequences are provided in Table 2 ...