Labshake search
Citations for Bio-Rad :
501 - 550 of 4528 citations for 6 O TOLYL IMIDAZO 2 1 B THIAZOLE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... and 2% Bis-Acrylamide (Bio-Rad) with milliQ water as described elsewhere 38 ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were blocked with 3% nonfat dry milk (BioRad 1706404) in 1X PBST for 30 min at room temperature and incubated with the GAPDH antibody (Cell Signaling Technology 2118 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and loaded on a 3-8% tris-acetate gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Microbiology 2019Quote: ... After washing the plate 3× (MAG3× setting on BioRad wash station) with wash buffer (PBS with 0.05% Tween20) ...
-
bioRxiv - Cell Biology 2019Quote: ... and loaded onto 3-8% Tris-acetate gels (Bio-rad, #3450131). Purified bovine 19S (UBPbio ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Cell Biology 2022Quote: ... at 400 mA for 3 hours using a MiniTransblot Module (BioRad). After protein transfer ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Protein concentration was quantified using a BCA assay and loaded at 25- 50ug in 1x Lamelli Buffer with B-mercaptoethanol onto a 4-15% TGX protean gel (Bio-Rad). In some experiments to achieve greater separation to detect the N-truncation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SYBR Green qPCR was performed using a ViiA7 (A&B Biosystems, Waltham, MA) with iTaq Universal SYBR Green One Step Kit (BioRad, #1725151) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins incubated with Mal-B were electrotransferred to PVDF membranes using a Trans-blot SD semi-dry transfer cell (Bio-Rad). Biotin incorporation was assessed by incubating blots with HRP-streptavidin (1:1000 v/v ...
-
bioRxiv - Microbiology 2022Quote: ... and 1’,3’-bis[1-palmitoyl-2-oleoyl-sn-glycero-3-phospho]-glycerol (16:0-18:1 Cardiolipin) were spotted using a Hamilton syringe onto a nitrocellulose membrane (Biorad trans-blot turbo RTA Midi 0.2 µm) to yield 10 ...
-
bioRxiv - Plant Biology 2020Quote: ... or 1 μl (for the rest) of a 1/2 dilution of the cDNA was added to a reaction containing 1X of SsoFast EvaGreen (Bio-Rad, USA), 0.5 μM Forward and Reverse primers (Table 2) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 60 of High Capacity NeutrAvidin slurry (Thermo PI29204) were washed three times with 1 mL 2X RIPA/1mM EDTA buffer in 2-mL chromatography columns (Bio-Rad 7326008) attached to a vacuum manifold (Promega A7231) ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were visualized with goat anti-mouse or goat anti-rabbit IgG secondary antibodies (1:5000) diluted in 2% Omniblot milk (AmericanBio) in 1X TBST using a chemiluminescence detection system (BioRad ChemiDoc MP).
-
bioRxiv - Biophysics 2023Quote: ... The mixture was incubated for 1-2 h at 4 °C and incubated overnight with pre-washed bio-beads (Bio-Rad Laboratories) at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were transferred to a nitrocellulose membrane using the iBlot 2 device and membranes were blocked for 1 hour at RT in 5% (w/v) Blotting Grade Blocker/PBS (Biorad, #170-6404). GCase was detected using rb mAb to hGBA antibody (abcam ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Protein lysates were boiled in loading buffer [1:9 ratio of 2-mercaptoethanol:4x Laemmli Sample Buffer (Cat.#1610747; Bio-Rad Laboratories)] for 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transfer buffer was prepared as a 1X final solution by mixing 7:2:1 of ddH2O: methanol: 10X Tris/Glycine Transfer Buffer (Bio-Rad #1610734). Following transfer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Microbiology 2020Quote: Extracellular concentrations of organic acids (acetate, lactate, formate) and ethanol (from 2.4.3) were determined by HPLC (BioRad HPX-87H 300*7.8 mm column ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentration was estimated on the lysates using a bicinchoninic acid protein assay Kit (5000111, Bio-Rad). Equal protein concentrations for each of the samples were incubated with Myc antibodies overnight ...
-
bioRxiv - Plant Biology 2019Quote: ... All reactions were run in hard-shell skirted 96-well plates with a white top and clear wells and sealed with Microseal ‘B’ adhesive film (BioRad, Hercules, CA). A CFX-96 detection system (BioRad ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...