Labshake search
Citations for Bio-Rad :
101 - 150 of 4871 citations for 6 N CARBETHOXY 3 CHLORO 7 8 DIHYDRO 5H PYRIDO 4 3 C PYRIDAZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... at 8°C in a MyCyclerTM thermal cycler (Bio-Rad). At the indicated intervals ...
-
bioRxiv - Microbiology 2023Quote: ... for the selected clinical isolates using the indicated concentrations of antibiotics via an alamar blue reduction assay completed as described but without shaking.8 After 3 days of incubation with the alamar blue reagent (BioRad, Hercules, CA, USA), the MIC was identified as the lowest concentration of drug that inhibited the reagent color change as determined visually.
-
bioRxiv - Microbiology 2019Quote: ... and 3 mg Bromophenol Blue) were separated by SDS-PAGE using 4-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Immunology 2023Quote: ... Protein denaturation before separation was done by treating the cell lysates for 3 min at 95°C in presence of 1x XT Sample Buffer (BioRad) and 1x XT reducing agent (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were resolved on gradient gels (4-8%; BioRad) and blotted onto nitrocellulose membranes ...
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: Frozen muscle biopsies were homogenised in modified Laemmli sample buffer as described previously.37 Samples were run in Bio-Rad Criterion 3–8 % tris-acetate gradient gels (Bio-Rad Laboratories, CA, USA) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Developmental Biology 2021Quote: ... Additional pre-absorption controls were performed in which the anti-IL-6 antibody was incubated overnight at 4 °C with a 10 fold molar excess of recombinant chicken IL-6 (1.67 μM; Bio-Rad Laboratories, Inc.) before immunolabeling fixed sections of chick ocular tissues ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... then to 97°C for 8 min in a thermocycler (BioRad). We centrifuged the samples and froze the supernatant for further use.
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were heated to 50°C for 2-3 min before addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-ATG GGT TCG CAT GGT CCT AAT GAC ACA C-3’) (Cousineau et al., 2022) and the GAPDH loading control (PrimePCR Probe assay with HEX probe, Bio-Rad). Each 20 µL reaction contained 500 ng of total RNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... microwells containing assembled protocell arrays were all incubated at 37 °C for 3 hours before imaging on a ChemiDoc MP (Bio-Rad) imaging system ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... run with radioactive sample for 15 min at 200 V, dried (80°C, 3 hours) on a gel dryer (Bio-Rad), and exposed to a phosphor screen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plates were incubated in the dark for 3 days at 30°C and then photographed in a Gel Doc XR+ (Bio-Rad).
-
bioRxiv - Immunology 2020Quote: ... 6µg of Round or Rod-shaped CCMVTT-VLPs were mixed with 2x mercaptoethanol and heated at 95°C for 3 minutes and then loaded into Any kD Mini-PROTEAN TGX precast protein gels (BIO-RAD). Gel was run for 35min at 180V ...
-
bioRxiv - Genomics 2022Quote: ... and incubated at 65°C for 3 mins before running 1% agarose-Etbr gel electrophoresis to detect the cleavage efficiency by ChemiDoc system (Bio-Rad).
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 hpf (n=40) or 48 hpf (n=25) embryos using the Aurum Total RNA Mini Kit (Bio-Rad). cDNA was then prepared with the RevertAid reverse transcriptase (Thermo Fisher) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...
-
bioRxiv - Biochemistry 2022Quote: ... before analysis on 8% SDS-PAGE or gradient (4-15%, BioRad) gels and western blotting using anti-FMRP (Cell signaling #LS-C82231 ...
-
bioRxiv - Biochemistry 2020Quote: ... N-glycans were reduced with 1 M NaBH4 in 50 mM KOH for 3 h at 50°C then desalted and enriched offline using AG 50W-X8 (Bio-Rad, Australia) strong cation exchange followed by porous graphitized carbon (PGC ...
-
bioRxiv - Developmental Biology 2019Quote: Oocytes were collected in 0.1% PVP in DPBS and boiled for 3 mins at 95°C in 1x Laemmli Sample Buffer (Bio-Rad, 161-0747) supplemented with β-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed 3 times with ice-cold PBS and boiled at 90 °C in 2x Laemnli sample buffer (Bio-Rad 1610737) for 5 minutes the following day for elution.
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Biophysics 2022Quote: ... N,N,N’,N’-Tetramethylethylenediamine (TEMED, 1610801, Bio-Rad), Ammonium persulfate (APS ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...