Labshake search
Citations for Bio-Rad :
251 - 300 of 5255 citations for 6 Methylimidazo 2 1 b thiazole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... diluted to 1:5,000 in 1X TBST 5% milk powder for 1 hour before visualisation with Clarity™ Western ECL Substrate (Bio-Rad, Hercules, California, US) using a Syngene G ...
-
bioRxiv - Developmental Biology 2020Quote: ... We ran the qPCR reactions using 1-2 µl cDNA in SYBR Green Master Mix (Biorad) totaling 20 µl in a Biorad CFX96 machine using 60°C as the annealing temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in monomer solution (1 x PBS, 2 M NaCl, 2.5% acrylamide (Bio-Rad), 0.15% Methylenbisacrylamide (Santa Cruz) ...
-
bioRxiv - Genetics 2022Quote: ... 1-2 μg RNA was used for cDNA synthesis using the iScript Advanced kit (Bio-Rad), following the manual.
-
bioRxiv - Microbiology 2022Quote: ... Commercial antibodies were used for β-tubulin (clone YL1/2, Bio-Rad, Watford, UK; 1:5000), β-actin (Abcam ab8227 ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were incubated with 6× Laemmle Sample Buffer (Bio-Rad) with 10% β-mercaptoethanol and boiled for 5 min at 100°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Following desalting with Micro Bio-spin 6 chromatography columns (Bio-Rad) twice ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 7.0 by passing through a MicroBioSpin-6 column (Bio-Rad), diluted 100-fold with the same buffer ...
-
bioRxiv - Physiology 2020Quote: ... followed by RNA purification with Micro Bio-spin 6 columns (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... and then run through Bio-Spin 6 columns (Bio-Rad #7326002) twice ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein band intensities were quantified via Image Lab 6 (Bio-Rad) as previously described in Stephani and Picchianti et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Excess compounds were removed by Bio-Gel P-6 columns (Biorad) according to the manufacturer’s protocol ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... by using gel filtration with P-6 Bio-Spin columns (BioRad). The resulting protein concentration was estimated to be ∼1-2 µM before native MS analysis.
-
bioRxiv - Molecular Biology 2022Quote: ... Following clean up with Micro Bio-Spin 6 columns (Bio-Rad), the 3’-end-labeled RNA was incubated with RNase A (Thermo Scientific(tm) ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Samples were then run on either 4-15% (a) or 8-16% (b) precast gels (Biorad), transferred onto 0.1μm nitrocellulose membranes and used for immunoblot detection ...
-
bioRxiv - Physiology 2019Quote: ... After loading wells were sealed with Microseal® ‘B’ seal (Bio-Rad Laboratories, the United Kingdom) avoiding that air bubbles ...
-
bioRxiv - Immunology 2020Quote: cDNA was generated from sorted B cells by adding 4µl of iScript (Bio-Rad Cat# 1708891) and cycling according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... cDNA synthesis from RNA was completed using 5x iScript RT Supermix (Bio-Rad, Catalog #L001404 B) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Single antigen-binding B cells were sorted using an S3 cell sorter (Bio-Rad, Hercules, CA), and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Biophysics 2022Quote: The purified proteins of V2HeR3 were reconstituted into a mixture of POPE and POPG membranes (molar ratio = 3:1) with a protein-to-lipid molar ratio of 1:20 by removing DDM using Bio-Beads (SM-2; Bio-Rad, CA, USA). The reconstituted samples were washed three times with 1 mM NaCl and 2 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysate was diluted at a 1:1 ratio with a solution of 2× Laemmli sample buffer (#1610737EDU, Bio-Rad, Hercules, CA, USA), containing 5% (v/v ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Cell Biology 2020Quote: ... TBST (50 mM Tris-HCl pH 7.4, 1% Triton X-100) with 5% non-fat milk (Bio-Rad) was used for blocking ...
-
bioRxiv - Genetics 2021Quote: ... Samples were then diluted 1:5 and placed into a 96 well plate with Supermix (no dUTPs, BioRad) and the required target locus primers and MGB-NFQ probes (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesized with 1-5 μg of RNA using iScript cDNA synthesis kit (Bio-Rad). mRNA levels were measured using qRT-PCR with SYBR Green Master Mix (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunohistochemistry was performed on paraffin sections (5 μm) using antibody F4-80 (Bio-rad, France; diluted 1:100). Sections were incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 min) and incubated for 1 h at room temperature with goat anti-rabbit IgG (H+L) (BioRad). Membranes were washed and signal was detected using the ChemiDoc XRS+ (Biorad ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were blocked for 1 h at rtp with 5% (w/v) non-fat milk block (Bio-Rad) in 1x TBS (in mM ...
-
bioRxiv - Physiology 2021Quote: ... Membranes were blocked 1 hour in skim milk 5% TBS-Tween buffer (TBST, Bio-Rad, 0.05% Tween 20), and incubated overnight with the primary antibodies diluted in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked for 1 h at room temperature with 5% non-fat dry milk (Bio-Rad Laboratories) in Tris-buffered saline (TBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... RLUC was detected with a primary anti-RLUC (MBL Life Sciences PM047) 1:2000 in TBST 5% BSA and a secondary anti-Rabbit IgG-HRP (Bio-Rad 170-6515; 1:10000) antibody in TBST 5% milk ...
-
bioRxiv - Cell Biology 2019Quote: ... RT-qPCR was performed on 2 μl of 1/25 diluted cDNA with a CFX-96 (Biorad) thermocycler ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatant was mixed with sample loading buffer supplemented with 1% v/v 2-mercaptoethanol (BioRad, Cat #1610710). Sample was not heated to prevent aggregation of the GPCR ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Genomics 2020Quote: ... and 6 µL H2O were mixed and incubated in a thermocycler (BioRad) using the following program ...
-
bioRxiv - Neuroscience 2019Quote: ... Non incorporated nucleotide was removed by Biospin 6 chromatography columns (Bio-rad). Before the hybridization procedure sections were transferred from –20 °C to room temperature and allowed to air dry ...
-
bioRxiv - Microbiology 2021Quote: ... Unincorporated nucleotides were removed using Micro Bio-Spin 6 columns (Bio-rad) according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Unreacted free dye was removed using P-6 Gel Columns (Bio-Rad). The labeling efficiency is about 1 Alexa Fluor 647 dye per antibody ...
-
bioRxiv - Biophysics 2019Quote: ... and purified using size exclusion chromatography (Micro Bio-Spin 6, Bio-Rad). The column purification was performed three times ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ethanol precipitation followed by P-6 Micro Bio-Spin Columns (Bio-Rad) were employed to remove unconjugated dyes.
-
bioRxiv - Genomics 2022Quote: ... purified on a Micro-Bio Spin P-6 Gel Column (Bio-Rad)and subsequently annealed to 5 µg of RNA extract ...
-
bioRxiv - Microbiology 2023Quote: ... for up to 6 h and imaged with the ChemiDoc (Bio-Rad). Signal intensities were quantified in ImageLab (Bio-Rad).