Labshake search
Citations for Bio-Rad :
101 - 150 of 3526 citations for 6 Methyl 3 5 heptadien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Micro Bio-Spin 6 Columns (molecular weight cutoff 6 kDa; Bio-Rad) were used at 1,000 × g and 4 °C to exchange purified protein samples to 250 mM ammonium acetate (99.99 % purity ...
-
bioRxiv - Cell Biology 2024Quote: 2-10ug of RNA extractions were loaded into a 5% acrylamide (Bio-Rad Laboratories: 1610156), 0.5x TBE (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: The 20 μl RT-dPCR reaction mixture consisted of 5 μl One-Step RT-dPCR Advanced Supermix for Probes (Bio-Rad, Laboratories, Munich, Germany), 2 µl of Reverse Transcriptase (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... They were then washed thrice with TBST (5 minutes/wash) at room temperature and signal developed for one minute using Clarity™ Western ECL substrate (Bio-Rad, Cat #: 1705060) or Clarity Max Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was then used to perform one-step qPCR with the iTaq One-Step system (Bio-Rad 1725151), and expression levels in mutant samples were normalized to Shh+/+ samples ...
-
bioRxiv - Plant Biology 2020Quote: ... detected with Pharox FXTM plus Molecular Imager and quantified by Quantity One one-dimensional analysis software (Bio-Rad). For luciferase reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Quantity One software (Bio-Rad, RRID:SCR_014280), version 4.1.1 ...
-
bioRxiv - Microbiology 2020Quote: ... and analyzed with Quantity One program (BIORAD).
-
bioRxiv - Molecular Biology 2021Quote: ... The Quantity One software from Bio-Rad was used for the quantification.
-
bioRxiv - Bioengineering 2019Quote: ... and Quantity One® software (BioRad®).
-
bioRxiv - Neuroscience 2020Quote: ... and quantified using Quantity One (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... and Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2020Quote: ... Quantity One imaging software (Bio-Rad Laboratories) was utilized to examine and quantify the intensity of protein bands.
-
bioRxiv - Biochemistry 2020Quote: ... and Quantity One 4.6.9 software (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... A one-step RT-PCR kit (BioRad) was used to detect the viral RNA using Applied Biosystems QuantStudio 12K Flex Real-Time PCR System with the following cycling protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and quantified using Quantity One (Bio-Rad).
-
bioRxiv - Plant Biology 2021Quote: ... and Quantity One® software (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... and Quantity One v4.6.9 (Bio-Rad, USA) to quantify protein and mRNA ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by heat-inactivation at 75°C for 5 min and desalting using Micro Bio-Spin P-6 columns (Bio-Rad, 7326221). Dephosphorylated guide RNAs were then radiolabeled using T4 Polynucleotide Kinase (0.33 U/µL ...
-
bioRxiv - Microbiology 2022Quote: ... NS5B-FAM probe: 5’-ATGGGTTCGCATGGTCCTAATGACACAC-3’) and the GAPDH loading control (PrimePCR Probe assay with HEX probe, Bio-Rad). Each 20 μL reaction contained 500 ng of total RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Biophysics 2024Quote: ... Blots were washed 3 times with TBST for 5 min and visualized using a ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Biophysics 2021Quote: ... DIV15-30 neurons were transfected 2-6 days before imaging via biolistic gene transfer (160 psi, Helios gene gun, Bio-Rad), as described in a detailed video protocol (Woods and Zito 2008) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were infected with SINV at an MOI of 2 and pictures were taken 6 hours post-infection using ZOE fluorescent cell imager (Bio-Rad). Proteins were collected with lysis buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% (w/v) SDS and 6% (v/v) β-mercaptoethanol) and protein concentrations were quantified using Bradford Protein Assay (Bio-Rad). Equal concentrations of protein were fractionated on NuPAGE 4-12% Bis-Tris Protein Gels ...
-
bioRxiv - Biochemistry 2021Quote: ... was incubated at 55°C for 2 h and then purified by 6% non-denaturing PAGE using a Prep Cell apparatus (Bio-Rad).
-
bioRxiv - Plant Biology 2022Quote: ... One-step RT-qPCR was performed using an iTaq Universal SYBR Green One-Step RT-qPCR Kit (BIO-RAD). The reaction was performed in a total volume of 20 μL by mixing 10 μL iTaq universal SYBR Green reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% of the lysates were boiled with 2 x laemmli buffer (BIO-RAD, Hercules, CA, USA) and used as input ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... the concentration of the resultant solution containing labelled αSyn was adjusted to 2 mg/mL and excess unbound dye was removed using Bio-Spin 6 size exclusion spin columns (Bio-Rad Laboratories). ATT565-αSyn was added to LUHMES cells on day six in vitro at a final concentration of 2 µM ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA was quantified via a one-step qRT-PCR using the iTaq universal probes one-step kit (Bio-Rad) per the manufacturer’s instructions for a 20µL reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... The amount of ATP for one cell was derived from the amount of protein in one cell found via Bradford assay (BioRad).
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the Quantity One 4.4.0 software (Bio-Rad).
-
The AAA-ATPase ATAD1 and its partners promote degradation of desmin intermediate filaments in musclebioRxiv - Cell Biology 2022Quote: ... Quantity One algorithm (Bio-Rad Laboratories, version 29.0) was used for densitometric measurements of intensity of protein bands.
-
bioRxiv - Cell Biology 2019Quote: ... Quantity One algorithm (Bio-Rad Laboratories version 29.0) was used for densitometric measurements of protein bands intensity.
-
bioRxiv - Biochemistry 2020Quote: ... and the Quantity One software package (Bio-Rad). Mitochondrial fractions were probed with antibodies raised against mitochondrial markers of the IMM ...
-
bioRxiv - Microbiology 2021Quote: ... followed by quantification using Quantity One (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... followed by quantification using Quantity One (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: Quantity One 1-D Analysis Software (Bio-Rad) was used to estimate band intensities of each sample ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantity One algorithm (Bio-Rad Laboratories version 29.0) was used for densitometric measurements of protein bands intensity.
-
bioRxiv - Developmental Biology 2023Quote: ... on a QX ONE Droplet Digital PCR (BioRad) following the manufacturer’s instructions ...