Labshake search
Citations for Bio-Rad :
1 - 50 of 796 citations for 6 Methoxy 3 methyl 1H indazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... is used for calibration (Figure 1H Biorad #7318223 connected to tubing Picture 1C Tygon #R-3603) ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... After 1h of blocking in 5% Blotting-Grade Blocker (Bio-Rad) in PBS + 0.05% Tween-20 (PBS-T) ...
-
bioRxiv - Physiology 2023Quote: ... and transferred (100V, 1h, 4°C) onto PVDF membranes (Bio-Rad). Blots were blocked in buffer containing 5% BSA (Cat#A9418 ...
-
bioRxiv - Neuroscience 2024Quote: ... at room temperature for 1h for ECL chemiluminescence detection system (Bio-Rad) development ...
-
bioRxiv - Genetics 2022Quote: ... 1h incubation at room temperature) and electrochemiluminescence detection (Clarity Max ECL; Bio-Rad). Membrane was eventually imaged using ChemiDoc MP imaging system (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... and migration was performed 1h at 170V in Tris-glycine buffer (Bio-rad) followed by Stain-Free gel activation using a ChemiDoc MP Imaging System (Bio-rad) ...
-
bioRxiv - Biophysics 2024Quote: ... the membranes were blocked for 1h in the EveryBlot blocking buffer (12010020, Biorad) and incubated overnight at 4°C with primary antibodies rabbit anti-Myf6 (sc-301 ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Biochemistry 2020Quote: ... Nonspecific sites were saturated with a blocking solution for 1h (EveryBlot Blocking Buffer, BioRad). Membranes were incubated overnight at 4□°C with anti-CD9 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were incubated 1h with HRP-conjugated secondary antibodies at 1:5,000 (Bio-Rad). After 4 more washes ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein transfer was performed at 110V for 1h onto 0.2 μm nitrocellulose membrane (Biorad). Membranes were stained in 0.2% Ponceau S (Thermo Fisher ...
-
bioRxiv - Biochemistry 2024Quote: ... We ran the gels for 1h at 120 V with Tris/Glycine/SDS buffer (Biorad) and stained the gels with InstantBlue protein stain (Expedeon ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked for 1h at room temperature with 5% Blotting-Grade Blocker (Bio-Rad, 1706404) in TBS-T buffer ...
-
bioRxiv - Genetics 2023Quote: ... The gels were run at 150V for 1h at room temperature in Tris·Glycine·SDS buffer (Bio-Rad) then transferred overnight at 4°C at 40mAmp to 0.22mm PVDF (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... and electroporated (square wave, 6 pulses, 30 V, 3 ms duration, 100 ms interval) using a gene Pulser XCell electroporator (Bio-Rad, 1652660). Zygotes were recovered and transferred to fresh KSOM drops and cultured overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... at 20V for 1h in a semi-dry Trans-Blot SD cell system (Bio-Rad, Hercules, CA). Following the blockade of the membranes using TBS-T (20 mM Tris ...
-
bioRxiv - Biophysics 2021Quote: ... Micro Bio-Spin 6 Columns (molecular weight cutoff 6 kDa; Bio-Rad) were used at 1,000 × g and 4 °C to exchange purified protein samples to 250 mM ammonium acetate (99.99 % purity ...
-
bioRxiv - Biophysics 2024Quote: ... BioSpin 6 columns (BioRad) were used to exchange tubulin into the desired buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... wet blotting (at 200 mA per gel for 1h) was applied to transfer proteins onto nitrocellulose membranes (BioRad). Membranes were then blocked for 45 min with either 1× RotiBlock (Carl Roth ...
-
bioRxiv - Microbiology 2022Quote: ... The gel was dried for 1h at 70 °C under vacuum in a Model 583 Gel Dryer (BioRad). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... and a horseradish peroxidase (HRP)-conjugated Goat anti-mouse antibody 1:10,000 dilutions (BioRad, 1h incubation 4°C). After three washes in PBS 0.1% tween ...
-
bioRxiv - Physiology 2021Quote: ... membranes were rinsed three-times in TBS/0.2% Tween for 10min and incubated for 1h with goat secondary anti-rabbit or anti-mouse IgG linked to peroxidase (dilution 1:5,000; Biorad) in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Genomics 2022Quote: ... membranes were rinsed threetimes in TBS/0.2% Tween for 10min and incubated for 1h with goat secondary anti-rabbit IgG linked to peroxidase (dilution 1:5,000; Biorad) in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h-incubation with HRP-conjugated secondary antibodies diluted in 5% milk in TBST (anti-mouse HRP (BioRad, 1706516) 1:10000 ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Physiology 2021Quote: ... membranes were rinsed three-times in TBS/0.2% Tween for 10min and incubated for 1h with goat secondary anti-rabbit IgG linked to peroxidase (dilution 1:5 000, Biorad) in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Immunology 2021Quote: ... Cell lysates were separated by protein electrophoresis at 150 V for 1h using 4-20% Mini-Protean TGX pre-cast gels (BioRad) and transferred by semi-dry technic onto Amersham Hybond-P PVDF membranes (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... The embryos were mounted on a 2 % agarose pad and heat-shocked at 30°C for 1h (Thermocycler Bio-Rad). After 2h recovery at 20°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 20% DMSO and 0.3M Glycine for 1h followed by a blocking step using an aqueous solution of 0.2% Triton X100 (Bio-Rad Laboratories), 0.2M Tris pH8 ...
-
bioRxiv - Cell Biology 2023Quote: ... And then blots were probed with secondary antibodies for 1h at room temperature before ECL development and imaging (Bio-Rad). The primary antibodies used for immunoblotting are as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Cancer Biology 2023Quote: ... Nitrocellulose membranes were blocked for 1h at RT in 5% Blotting Grade Blocker Non-Fat Dry Milk (Biorad, Hercules, CA, USA) and TBST ...
-
bioRxiv - Immunology 2024Quote: ... the proteins were transferred to a polyvinylidene difluoride membrane (110V, 1h, 4°C) using a Mini Trans-Blot cell apparatus (Bio-Rad). Non-specific binding sites were blocked using PBS/Tween 20 (0.05% Tween 20 ...
-
bioRxiv - Cell Biology 2023Quote: ... Slides were then washed in PBS and blocked for 1h in 20 mm Tris Buffered Saline with 0.1% Tween-20 (BioRad, catalog #1610781) (TBS-T ...
-
bioRxiv - Cancer Biology 2024Quote: ... membranes were incubated for 1h with HRP-conjugated goat secondary antibodies against mouse or rabbit immunoglobulin (1:3000, 170-6516, 170-6515, Bio-Rad). Proteins were visualized on an iBright™ CL1000 Imaging System (ThermoFisher ...
-
bioRxiv - Bioengineering 2020Quote: ... the 96-well microplate was incubated at 37 °C for 1h and the end-point image was taken by ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... Secondary antibody incubation was done at room temperature for 1h (HRP-conjugated goat anti-rabbit IgG, 1:2000 dilution, Bio-Rad, 403005). Membranes were washed with Tris-buffered saline containing 0.05% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... PAGE gels were run at 130V for ∼1h in Bis-Tris buffer (GeneScript) and then wet transferred to a 0.2 µm PVDF membrane (BioRad, activated in 100% methanol) at 100V for ∼1 h in 1X transfer buffer containing 20% methanol ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... and then buffer exchanged into 150 mM ammonium acetate pH 7.5 by two consecutive passes over centrifugal gel filtration columns (Micro Bio-Spin P-6, 6-kDa cut off; BioRad). Protein concentration was verified by A280 ...