Labshake search
Citations for Bio-Rad :
51 - 100 of 735 citations for 6 FLUORO THIOCHROMAN 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... and purified using size exclusion chromatography (Micro Bio-Spin 6, Bio-Rad). The column purification was performed three times ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ethanol precipitation followed by P-6 Micro Bio-Spin Columns (Bio-Rad) were employed to remove unconjugated dyes.
-
bioRxiv - Genomics 2022Quote: ... purified on a Micro-Bio Spin P-6 Gel Column (Bio-Rad)and subsequently annealed to 5 µg of RNA extract ...
-
bioRxiv - Microbiology 2023Quote: ... for up to 6 h and imaged with the ChemiDoc (Bio-Rad). Signal intensities were quantified in ImageLab (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Cancer Biology 2023Quote: ... and a 6-Plex Mouse Cytokine Panel (Bio-Rad Laboratories; Hercules, California). Insulin-like growth factor 1 (IGF-1 ...
-
bioRxiv - Biochemistry 2023Quote: ... or through a Mini Bio-Gel P-6 Desalting Cartridge (Bio-Rad). The concentration of the protein was determined by using the absorption measured at 280 nm and the corresponding extinction coefficient of 20970 M-1cm-1.
-
bioRxiv - Biochemistry 2023Quote: ... or through a Mini Bio-Gel P-6 Desalting Cartridge (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... using two cycles of spin gel-filtration (MicroBioSpin P-6, Bio-Rad). The complex was subsequently diluted by 20 mM AA to 0.5 µM (estimated based on 3+3 stoichiometry) ...
-
bioRxiv - Biochemistry 2024Quote: ... a calibration curve was created using Microplate Manager® 6 (Bio-Rad) to calculate the intracellular SAM concentration.
-
bioRxiv - Microbiology 2024Quote: ... All assays were desalted by Micro Bio-Spin 6 columns (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... Unincorporated nucleotides were removed by Micro Bio-Spin 6 columns (Bio-Rad) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2022Quote: ... a desalting step was performed using micro Bio-Spin™ 6 (BIO-RAD) with 500mM ammonium acetate ...
-
bioRxiv - Immunology 2021Quote: ... followed by desalting using Micro Bio-spin 6 Chromatography Columns (Biorad, 732-6200). Then ...
-
bioRxiv - Immunology 2022Quote: ... using Iodogen reaction and then purified by P-6 spin column (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using primers shown in Supplementary Table 6 and IQ SYBRGreen supermix (Bio-Rad). The relative standard curve method was used to calculate arbitrary gene expression using CFX-manager software (Bio-Rad) ...
-
bioRxiv - Biochemistry 2019Quote: ... bead supernatant was transferred to gel filtration column (Micro-Bio Spin 6, BioRad). Filtrate was added onto DNA Polymerase 1 (PolI ...
-
bioRxiv - Biochemistry 2021Quote: ... Excess MTS reagents were removed with Micro Bio-Spin 6 columns (Bio-Rad) equilibrated in crosslinking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were purified with Micro Bio-Spin P-6 columns (Bio-Rad Laboratories) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were buffer-exchanged using Micro Bio-Spin 6 desalting column (Bio-Rad) into 200mM ammonium acetate (pH adjusted to 7.4 with ammonium hydroxide) ...
-
bioRxiv - Cell Biology 2024Quote: ... The labeled antibodies are purified by P-6 Micro Bio-Spin Columns (BioRad).
-
bioRxiv - Cell Biology 2024Quote: ... PCR reactions were performed with Applied Biosystems QuantStudio 6 Flex using Sybrgreen (Biorad). Assays were performed in duplicate ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Neuroscience 2022Quote: ... and analyzed with Opticon Monitor 3 and GeneX (BioRad) software ...
-
bioRxiv - Molecular Biology 2023Quote: ... from a 3% low range agarose gel (BioRad, 1613107) to remove adapter dimers.
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed in 3% paraformaldehyde (Bio-rad) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... Nuclei were counted on an automated cell counter (TC20 BioRad, range 4-6 um) and further confirmed intact under microscope ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were counted on an automated cell counter (TC20 BioRad, range 4-6 um) and further confirmed intact under microscope ...
-
bioRxiv - Microbiology 2020Quote: ... un-conjugated dye was removed using a Micro Bio-Spin P-6 column (BioRad) at 1000 x g ...
-
bioRxiv - Microbiology 2020Quote: ... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was purified on a Bio-Spin® P-6 Gel Columns (BioRad) desalting column equilibrated in BC-0 buffer to separate labeled protein from excess fluorophore and then stored at −80 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and subsequently purified using Micro Bio-Spin P-6 gel columns (Bio-Rad 7326221). The BG-oligos were then conjugated to SNAP-proteins by mixing at a 2:1 molar ratio in storage buffer (20 mM HEPES [pH 7.5] ...
-
bioRxiv - Molecular Biology 2019Quote: ... Gel exclusion chromatography on Bio-Gel P-6 acrylamide resin (Bio-Rad #150-0740) in renaturation and storage buffer RN#5 (0.1 M NaH2PO4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 6-well plates were imaged using a chemidoc (Bio-Rad, Hercules, CA, USA) and the number of colonies was counted in CellProfiler using an automated analysis pipeline ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons at DIV 4-6 were transfected using a biolistic gene gun (Bio-Rad) and were assayed 3 days after transfection as described previously (5,6,26,27) ...