Labshake search
Citations for Bio-Rad :
251 - 300 of 4884 citations for 6 FLUORO 2 METHYL 3 4 PIPERIDINE 1H INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Genomics 2020Quote: ... and 6 µL H2O were mixed and incubated in a thermocycler (BioRad) using the following program ...
-
bioRxiv - Neuroscience 2019Quote: ... Non incorporated nucleotide was removed by Biospin 6 chromatography columns (Bio-rad). Before the hybridization procedure sections were transferred from –20 °C to room temperature and allowed to air dry ...
-
bioRxiv - Microbiology 2021Quote: ... Unincorporated nucleotides were removed using Micro Bio-Spin 6 columns (Bio-rad) according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Unreacted free dye was removed using P-6 Gel Columns (Bio-Rad). The labeling efficiency is about 1 Alexa Fluor 647 dye per antibody ...
-
bioRxiv - Biophysics 2019Quote: ... and purified using size exclusion chromatography (Micro Bio-Spin 6, Bio-Rad). The column purification was performed three times ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ethanol precipitation followed by P-6 Micro Bio-Spin Columns (Bio-Rad) were employed to remove unconjugated dyes.
-
bioRxiv - Genomics 2022Quote: ... purified on a Micro-Bio Spin P-6 Gel Column (Bio-Rad)and subsequently annealed to 5 µg of RNA extract ...
-
bioRxiv - Microbiology 2023Quote: ... for up to 6 h and imaged with the ChemiDoc (Bio-Rad). Signal intensities were quantified in ImageLab (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... or through a Mini Bio-Gel P-6 Desalting Cartridge (Bio-Rad). The concentration of the protein was determined by using the absorption measured at 280 nm and the corresponding extinction coefficient of 20970 M-1cm-1.
-
bioRxiv - Biochemistry 2023Quote: ... or through a Mini Bio-Gel P-6 Desalting Cartridge (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... and a 6-Plex Mouse Cytokine Panel (Bio-Rad Laboratories; Hercules, California). Insulin-like growth factor 1 (IGF-1 ...
-
bioRxiv - Biochemistry 2024Quote: ... a calibration curve was created using Microplate Manager® 6 (Bio-Rad) to calculate the intracellular SAM concentration.
-
bioRxiv - Biochemistry 2023Quote: ... using two cycles of spin gel-filtration (MicroBioSpin P-6, Bio-Rad). The complex was subsequently diluted by 20 mM AA to 0.5 µM (estimated based on 3+3 stoichiometry) ...
-
bioRxiv - Microbiology 2024Quote: ... Unincorporated nucleotides were removed by Micro Bio-Spin 6 columns (Bio-Rad) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... All assays were desalted by Micro Bio-Spin 6 columns (Bio-Rad).
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bis (2%, Bio-Rad), the sonicated nanorod-water solution (sonicated in in bath sonicator for one hour ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Immunology 2022Quote: ... incubated for five days at 4°C in 40 mL of hydrogel monomer solution [4% acrylamide (Bio-Rad), 0.05% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... and resolved by SDS-PAGE using Criterion XT Bis-Tris precast gels (4-12%; BioRad, 3450123/4/5) and XT-MES1X as running buffer (stock 10X ...
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...