Labshake search
Citations for Bio-Rad :
1 - 50 of 1914 citations for 6 Ethyl N N dimethyl 1H pyrrolo 2 3 b pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... N,N,N’,N’-Tetramethylethylenediamine (TEMED, 1610801, Bio-Rad), Ammonium persulfate (APS ...
-
bioRxiv - Cell Biology 2020Quote: ... n,n’-methylene-bis-acrylamide (BIORAD, 2% w/v stock solution), N-6-((acryloyl)amino)hexanoic acid crosslinker (N6 ...
-
bioRxiv - Neuroscience 2019Quote: ... N,N,N’,N’-Tetra-methyl ethylenediamine (TEMED, Bio-Rad, 161-0801), 10% ammonium persulfate (APS ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.035-0.25% N,N-methylenebisacrylamide crosslinker (Bis, 2% w/v stock, 161040, BioRad), 0.06% SDS (5% w/v stock in DI water ...
-
bioRxiv - Bioengineering 2023Quote: ... 35 µL N,N-methylenebisacrylamide crosslinker (2% w/v bis-acrylamide Solution, 1610142, Bio-Rad), 20 µL of 1:100 diluted fluorescent beads in DI water (FluoSpheres carboxylate-modified 0.2 µm ...
-
bioRxiv - Bioengineering 2024Quote: ... 35 µL N,N-methylenebisacrylamide crosslinker (2% w/v bis-acrylamide Solution, 1610142, Bio-Rad), 20 µL of 1:100 diluted fluorescent beads in DI water (FluoSpheres carboxylate-modified 0.2 µm ...
-
bioRxiv - Immunology 2019Quote: ... and N,N-methylene-bisacrylamide (Bio-Rad) to achieve the range of desired elasticities with a Poisson’s ratio of 0.5 ...
-
bioRxiv - Immunology 2019Quote: ... and N,N-methylene-bisacrylamide (Bio-Rad) to achieve the range of elasticity ...
-
bioRxiv - Microbiology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Bioengineering 2019Quote: Proliferation of MSCs was evaluated by determining the total cell count per well (n=3 wells/treatment/time-point) using a TC20 Automated Cell Counter (Bio-Rad).
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Physiology 2021Quote: ... RNA was transferred onto a nylon membrane (Hybond-N; Biodyne B) using Trans-Blot Turbo (Bio-Rad) at 25 V for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Biochemistry 2022Quote: ... stock solution of 40% neutral acrylamide and N,N’-methylenebisacrylamide in a 19:1 ratio (Bio-Rad) were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt ...
-
bioRxiv - Molecular Biology 2021Quote: Purified SARS-CoV-2 N protein was electrophoresed on 4-10% SDS-PAGE (Bio-Rad) and stained with Coomassie Brilliant Blue G-250 (CBBG-250) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 hpf (n=40) or 48 hpf (n=25) embryos using the Aurum Total RNA Mini Kit (Bio-Rad). cDNA was then prepared with the RevertAid reverse transcriptase (Thermo Fisher) ...
-
bioRxiv - Biophysics 2023Quote: ... extracted agarose gel parts were divided by cutting several times and purified via Freeze N′ Squeeze columns (Freeze N′ Squeeze, 7326165, BioRad) according to the manufacturer’s instructions using a benchtop centrifuge (Biofuge fresco ...
-
bioRxiv - Biophysics 2019Quote: ... N-methylene-bis-acrylamide (Bio-Rad, Herculers, USA) are added ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Bioengineering 2019Quote: ... by means of O/N wet transfer (Bio-Rad) 4 °C at 30 V ...
-
bioRxiv - Biochemistry 2020Quote: ... Biotinylated small RNAs were separated from HPDP-biotin and pyridine-2-thione using spin columns (BioRad) in ultra-pure water.
-
bioRxiv - Microbiology 2022Quote: ... anti-Metapneumovirus N mouse monoclonal (1:25) (MCA4674, Bio-Rad), or anti-Influenza A nucleoprotein (NP ...
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2023Quote: ... Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad, Cat Nos. 12015406 and 12014773), and Bio-Plex Pro Human IgA detection antibody (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... was purchased from G-Biosciences and Freeze ‘N Squeeze DNA gel extraction columns by Bio-rad, Inc ...
-
bioRxiv - Biophysics 2022Quote: ... which were subsequently used with Freeze ‘N Squeeze spin columns (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second serum panel (n=29 ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 29 sera collected from individuals 1 month after BA.5-bivalent-booster of Pfizer or Moderna vaccine ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then run on a 2% agarose gel with 1x SYBR Safe for 2 hours at 120 V before gel extraction with a Freeze ‘N Squeeze column (Bio-Rad). After extraction ...
-
bioRxiv - Microbiology 2023Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 20 sera from individuals who were previously infected by SARS-CoV-2 vaccinated with 2-4 doses of parental mRNA vaccine ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... final concentrations of 2X SsoADV Universal SYBR Green Supermix (BIORAD, n° 1725270) and 0.04μM of each primer ...
-
bioRxiv - Biophysics 2023Quote: ... and samples were extracted with Freeze N’ Squeeze spin columns (Bio-Rad) by centrifugation at 1,000 g for 60 minutes at 4 ºC ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Immunology 2023Quote: Serum binding antibody assays were performed to evaluate IgG responses to SARS-CoV-2 nucleocapsid and ancestral spike S2 domains and RBD using the Bio-Plex Pro Human SARS-CoV-2 IgG (N, S2, RBD) 4-Plex Panel serology assay (Bio-Rad 12014634) as previously described (8).
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Cell Biology 2020Quote: ... crushed and structures were purified with Freeze ‘N Squeeze spin columns (Bio-Rad) for 5 min at 1,000×g at 4 °C.