Labshake search
Citations for Bio-Rad :
251 - 300 of 3194 citations for 6 Chloro 1 benzofuran 7 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Immunology 2021Quote: ... Basically 300 ug of IVIG protein were subjected to isoelectric focusing (IPG) across pH gradients of 4-7 (Biorad, LifeSciences, Hercules, Ca, USA) or pH 6-11 (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred to nitrocellulose membrane by semi-dry transfer using the Trans-Blot Turbo Transfer System (BioRad, 1.5 A for 7 min). Membranes were blocked in 5% milk in 1x PBS with 0.1% Tween 20 (PBST ...
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were transferred to a PVDF membrane (0.2 µm pore size) using the Trans-Blot® Turbo™ semi-dry transfer system (7 min mixed MW MIDI program) (Bio-Rad). After blocking in a 2.5% (w/v ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was quenched with 2µl of 10mM EDTA and desalted with Microbio-spin 6 column (BioRad) to remove unincorporated nucleotides ...
-
bioRxiv - Biochemistry 2020Quote: ... The thiol-reduced protein was exchanged into anaerobic 0.5x TNG buffer using Microbiospin 6 columns (Bio-Rad). The protein concentration was determined by the Bradford assay (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Unconjugated dye was removed by passing the protein through Micro Bio-spin P-6 column (Bio-rad) equilibrated in GF150 buffer (25 mM HEPES (pH 7.4) ...
-
bioRxiv - Microbiology 2020Quote: ... separated on 6% acrylamide 8M urea gels and transferred to Zeta Probe GT membranes (Bio-Rad laboratories) by electroblotting ...
-
bioRxiv - Plant Biology 2019Quote: ... 5- to 6-week-old expanded leaves of Arabidopsis plants were bombarded with 1nm gold particles (BioRad) coated with pB7WG2.0-GFP and pB7WG2.0-RFPER ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein lysates (50µg) were loaded on a 6% SDS-PAGE gel and transferred to nitrocellulose membrane (BioRad) using a wet electroblotting system (BioRad) ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed with TBST (6 × 5 min) and developed using Clarity Western ECL Substrate (Bio-Rad, California, US). Images were captured with ChemiDoc XRS+ system (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA preparation involves coating 10 μl of .6 μm Gold microcarriers (1652262 Bio-Rad, Hercules, CA) with 1μg of purified DNA by gently vortexing DNA ...
-
bioRxiv - Immunology 2021Quote: ... IL-18 and IL-6 concentrations were measured using the Bio-Plex Pro Human Cytokine Assay (BioRad).
-
bioRxiv - Plant Biology 2022Quote: ... cumana KAI2d1-6 genes from parental lines and segregants using iProof High-Fidelity DNA Polymerase (BioRad #172530). The PCR products were then sequenced via MiSeq ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction mixture was desalted by twice passing through Micro Bio-spin 6 chromatography columns (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction mixture was desalted by twice passing through Micro Bio-spin 6 chromatography columns (Bio-Rad).
-
bioRxiv - Plant Biology 2023Quote: ... the treated protein was cleaned up using a Micro Bio-SpinTM P-6 Gel Column (BIO-RAD), and then they were further subjected to 5 mM sodium (meta ...
-
bioRxiv - Molecular Biology 2023Quote: ... then resuspended in 600 µl TNM100 buffer and transferred into Micro Bio-Spin 6 columns (Bio-Rad). The elution from IgG Sepharose beads was achieved by incubation with 30 µl homemade GST-tagged TEV protease for two hours on a shaking table at 16 °C.
-
bioRxiv - Developmental Biology 2023Quote: ... and monitoring of mCherry expression after 6 and 22 h (ZOE fluorescent cell imager, Bio-Rad, 1450031).
-
bioRxiv - Biophysics 2020Quote: ... We visualized the transcription products by electrophoresis in a denaturant gel (23% polyacrylamide, 7 M urea) run at 800V for 2 h (Bio-rad, Hercules, CA, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... Approximately 50 ng cDNA from each sample was mixed with gene-specific primers (Supplementary Table 7) and SsoAdvanced™ universal SYBR® Green supermix (Bio-Rad Laboratories) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was performed with KOD SYBR qPCR Mix (TOYOBO) and primers (Supp Table 7) using the CFX Connect Real-Time PCR Detection System (Bio-Rad; Hercules, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... 30 μL egg extract was applied to and eluted from a Micro Bio-Spin 6 column (Bio-Rad) equilibrated in ELB150 ...
-
bioRxiv - Plant Biology 2021Quote: ... At least 4-6 technical replicate RT-qPCR reactions were performed using iTAQ with ROX and SYBR (BioRad), and 20μL reactions were prepared as per the manufacturer recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.032 % (w/v) SM was applied to a centrifugal device (Micro Bio-Spin 6, Bio-Rad, Hercules) to exchange the buffer to a MS buffer containing 200 mM ammonium acetate (pH 7.4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was purified by loading quenched samples onto Micro Bio-spin Columns with Bio-Gel P-6 (BioRad), followed by ethanol precipitation ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by 6 washes in 100 µL of PBST in Bio-Spin columns (catalog number 7326204, Bio-Rad). The bound immunocomplexes were eluted via 0.1 M glycine ...
-
bioRxiv - Biochemistry 2021Quote: KirBac3.1 protein was buffer-exchanged to 200 mM ammonium acetate (pH=8.0) with 0.5% C8E4 (2×CMC) using a Biospin-6 column (BioRad). The protein sample was loaded into a gold coated needle prepared in-house and analysed on a modified Q-Exactive mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... then washed 6 x 5 minutes with TBS-T before developing with Clarity Western ECL Substrate (Bio-rad).
-
bioRxiv - Biochemistry 2022Quote: ... solutions containing purified CytbX were buffer-exchanged into 0.2 M ammonium acetate (pH 8.0) containing 2x CMC of Lauryldimethylamine oxide (LDAO) using Biospin 6 columns (Biorad). 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher ...
-
bioRxiv - Biophysics 2022Quote: ... then 6 L of RO water with Ca2+ chelating beads (BIO-RAD Chelex 100 Resin Cat#142-1253), and finally 6 L of RO water alone ...
-
bioRxiv - Microbiology 2023Quote: ... separated on 6% acrylamide 8 M urea gels and transferred to Zeta Probe GT membranes (Bio-Rad laboratories) by electroblotting ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was then cleaned 2-times on Micro Bio-Spin™ P-6 gel Columns (BioRad, #732-6221) where buffer was exchanged with phase separation buffer ...
-
bioRxiv - Biochemistry 2022Quote: LiRecT protein was buffer exchanged into 100 mM ammonium acetate pH 7 (unadjusted) using Micro BioSpin P6 spin columns (Bio-Rad Laboratories, Hercules, CA, USA). All ssDNAs were dialyzed into 100 mM ammonium acetate with Pierce 96-well microdialysis devices with 3.5K MWCO (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... before transfer onto a nitrocellulose membrane (Transblot Turbo Transfer Pack Midi 0.2 μm) for 7 min using the Transblot Turbo Transfer System (BioRad, program: Quickblot Mixed MW, Midi Gel). Membranes were incubated for 1 hour in blocking buffer (10% BSA ...
-
bioRxiv - Physiology 2022Quote: ... Proteins were then either semi-dry transferred onto a polyvinylidene difluoride membrane at 1.3 A and 25 V for 7 min (Trans-Blot® Turbo™ Transfer System, Bio-Rad, Hercules, California, USA) or wet transferred onto nitrocellulose membrane at 100 V for 90 min (i.e. ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were incubated overnight at 4 °C with rabbit anti-chick IL-6 (Bio-Rad Laboratories, Inc., Hercules, CA) diluted 1:20 in incubation buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Excess dye was removed by two consecutive buffer exchanges through Micro Bio-Spin P-6 desalting columns (Bio-Rad). Protein concentration and labeling efficiency were estimated using a NanoDrop Microvolume Spectrophotometer.