Labshake search
Citations for Bio-Rad :
551 - 600 of 4878 citations for 6 Chloro 1 2 dihydro 3H indazol 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Immunology 2023Quote: Plasma from control and infected mice was used at a 1:2 and 1:4 dilution with the Bio-Plex Pro Mouse Cytokine 23 Plex Immunoassay (Bio-Rad Laboratories, Inc., CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: 2 ⨯ 106 CAR T cells collected after 24-day expansion were resuspended with 1 ⨯ Laemmli sample buffer (BIORAD) containing 2.5% β-mercaptoethanol before sonication with 50% amplitude in Sonic Dismembrator (FisherBrand) ...
-
bioRxiv - Biochemistry 2020Quote: ... Both PK-treated and untreated samples were then mixed 1:2 with 4X Laemmli sample buffer (Bio-Rad) containing DTT ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-α-tubulin YL1/2 from rat (MCA77G, Bio-Rad AbD Serotec, at 1:2000 dilution for IF), anti-rabbit Alexa Fluor 488 (A11008 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized from total RNA (1-2 μg) with iScript Advanced cDNA Synthesis Kit (Bio-Rad; 1725038). Quantitative RT-PCR (qPCR ...
-
bioRxiv - Genetics 2023Quote: ... 1 ml 2xYNB with 2% glucose was added to the sorted cells in sheath fluid (PBS, BioRad #12012932) and they were transferred to a shaking incubator and grown at 30 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bis (2%, Bio-Rad), the sonicated nanorod-water solution (sonicated in in bath sonicator for one hour ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Immunology 2020Quote: ... a total of 6 × 107 cells was incubated in staining buffer with mouse anti-pig CD4 alpha (clone MIL17, Bio-Rad AbD Serotec, Puchheim, Germany, 1:50) at 4°C for 20 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were rinsed 3×10 minutes in TBST 0.1% then incubated with appropriate secondary antibody coupled to the horseradish peroxidase (Biorad, 1706515, 1706516; 1/5000) for 1 hour at room temperature under agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Microbiology 2022Quote: ... a desalting step was performed using micro Bio-Spin™ 6 (BIO-RAD) with 500mM ammonium acetate ...
-
bioRxiv - Immunology 2021Quote: ... followed by desalting using Micro Bio-spin 6 Chromatography Columns (Biorad, 732-6200). Then ...
-
bioRxiv - Immunology 2022Quote: ... using Iodogen reaction and then purified by P-6 spin column (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using primers shown in Supplementary Table 6 and IQ SYBRGreen supermix (Bio-Rad). The relative standard curve method was used to calculate arbitrary gene expression using CFX-manager software (Bio-Rad) ...
-
bioRxiv - Biochemistry 2019Quote: ... bead supernatant was transferred to gel filtration column (Micro-Bio Spin 6, BioRad). Filtrate was added onto DNA Polymerase 1 (PolI ...
-
bioRxiv - Biochemistry 2021Quote: ... Excess MTS reagents were removed with Micro Bio-Spin 6 columns (Bio-Rad) equilibrated in crosslinking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were purified with Micro Bio-Spin P-6 columns (Bio-Rad Laboratories) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were buffer-exchanged using Micro Bio-Spin 6 desalting column (Bio-Rad) into 200mM ammonium acetate (pH adjusted to 7.4 with ammonium hydroxide) ...
-
bioRxiv - Cell Biology 2024Quote: ... The labeled antibodies are purified by P-6 Micro Bio-Spin Columns (BioRad).
-
bioRxiv - Cell Biology 2024Quote: ... PCR reactions were performed with Applied Biosystems QuantStudio 6 Flex using Sybrgreen (Biorad). Assays were performed in duplicate ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Neuroscience 2022Quote: ... and analyzed with Opticon Monitor 3 and GeneX (BioRad) software ...
-
bioRxiv - Molecular Biology 2023Quote: ... from a 3% low range agarose gel (BioRad, 1613107) to remove adapter dimers.
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed in 3% paraformaldehyde (Bio-rad) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... One microgram of RNA was used to synthesize cDNA using the iScript cDNA synthesis kit (Bio-Rad). cDNA was amplified using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gels were analysed using a Bio-Rad Personal Molecular Imager (PMI) and Quantity One software (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... A 20μl reaction mixture was prepared using the iTaq Universal probes One-Step kit (BioRad, Hercules, CA), according to manufacturer instructions ...