Labshake search
Citations for Bio-Rad :
451 - 500 of 8138 citations for 6 Amino 5 2 chloro 4 nitrophenyl azo naphthalene 1 sulfonamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were incubated with 6× Laemmle Sample Buffer (Bio-Rad) with 10% β-mercaptoethanol and boiled for 5 min at 100°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Following desalting with Micro Bio-spin 6 chromatography columns (Bio-Rad) twice ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 7.0 by passing through a MicroBioSpin-6 column (Bio-Rad), diluted 100-fold with the same buffer ...
-
bioRxiv - Physiology 2020Quote: ... followed by RNA purification with Micro Bio-spin 6 columns (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... and then run through Bio-Spin 6 columns (Bio-Rad #7326002) twice ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein band intensities were quantified via Image Lab 6 (Bio-Rad) as previously described in Stephani and Picchianti et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Excess compounds were removed by Bio-Gel P-6 columns (Biorad) according to the manufacturer’s protocol ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... by using gel filtration with P-6 Bio-Spin columns (BioRad). The resulting protein concentration was estimated to be ∼1-2 µM before native MS analysis.
-
bioRxiv - Molecular Biology 2022Quote: ... Following clean up with Micro Bio-Spin 6 columns (Bio-Rad), the 3’-end-labeled RNA was incubated with RNase A (Thermo Scientific(tm) ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 100 V for 1 hr in 4°C pre-chilled 1X Tris-Glycine buffer (Bio-Rad 161-0734). Membranes were blocked for 1 hr at room temperature in blocking buffer (PBS (Gibco 14190-144) ...
-
bioRxiv - Biochemistry 2020Quote: ... The reconstitution sample was nutated for 1 h at 4°C before addition of 0.2 g/mL SM2-BioBeads (BioRad), and the reconstitution sample was further nutated overnight at 4°C before removal of the biobeads ...
-
bioRxiv - Microbiology 2020Quote: ... 7.5 mg of proteins were diluted in ChIP buffer supplemented with 0.01% SDS and precleared 1 h at 4 °C with 50 μl of protein A agarose beads (BioRad) and 100 μg BSA ...
-
bioRxiv - Neuroscience 2020Quote: ... Blots were washed 4 times with TBST and incubated with secondary antibody (1:2000, HRP-conjugated anti rabbit, BioRad) for 1hr at room temperature then washed 4 times with TBST ...
-
bioRxiv - Bioengineering 2021Quote: ... A sample containing 1-20µg of protein was loaded into a 4-15% precast gel (Bio-Rad Mini-ProTEAN) and run at 60V for 20min followed by 160V for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were stained overnight at 4°C with a 1:1000 diluted mouse anti-his primary antibody (MCA1396, RRID:AB_322084, Bio-Rad) and then for 1 hour at room temperature with a 1:4000 diluted rabbit anti-mouse HRP secondary antibody (SouthernBiotech Cat# 6170-05 ...
-
bioRxiv - Biochemistry 2023Quote: ... CCT was immunoprecipitated from the lysate by adding 4 µg of a CCT5 antibody (BioRAD MCA2178, 1:100 IP) and incubating for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Biophysics 2022Quote: The purified proteins of V2HeR3 were reconstituted into a mixture of POPE and POPG membranes (molar ratio = 3:1) with a protein-to-lipid molar ratio of 1:20 by removing DDM using Bio-Beads (SM-2; Bio-Rad, CA, USA). The reconstituted samples were washed three times with 1 mM NaCl and 2 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysate was diluted at a 1:1 ratio with a solution of 2× Laemmli sample buffer (#1610737EDU, Bio-Rad, Hercules, CA, USA), containing 5% (v/v ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... TBST (50 mM Tris-HCl pH 7.4, 1% Triton X-100) with 5% non-fat milk (Bio-Rad) was used for blocking ...
-
bioRxiv - Genetics 2021Quote: ... Samples were then diluted 1:5 and placed into a 96 well plate with Supermix (no dUTPs, BioRad) and the required target locus primers and MGB-NFQ probes (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesized with 1-5 μg of RNA using iScript cDNA synthesis kit (Bio-Rad). mRNA levels were measured using qRT-PCR with SYBR Green Master Mix (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunohistochemistry was performed on paraffin sections (5 μm) using antibody F4-80 (Bio-rad, France; diluted 1:100). Sections were incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 min) and incubated for 1 h at room temperature with goat anti-rabbit IgG (H+L) (BioRad). Membranes were washed and signal was detected using the ChemiDoc XRS+ (Biorad ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were blocked for 1 h at rtp with 5% (w/v) non-fat milk block (Bio-Rad) in 1x TBS (in mM ...
-
bioRxiv - Physiology 2021Quote: ... Membranes were blocked 1 hour in skim milk 5% TBS-Tween buffer (TBST, Bio-Rad, 0.05% Tween 20), and incubated overnight with the primary antibodies diluted in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked for 1 h at room temperature with 5% non-fat dry milk (Bio-Rad Laboratories) in Tris-buffered saline (TBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... RLUC was detected with a primary anti-RLUC (MBL Life Sciences PM047) 1:2000 in TBST 5% BSA and a secondary anti-Rabbit IgG-HRP (Bio-Rad 170-6515; 1:10000) antibody in TBST 5% milk ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4-20% precast gels (BioRad). Gels were transferred onto Immobilon-P PVDF membrane (EMD Millipore) ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Cell Biology 2019Quote: ... RT-qPCR was performed on 2 μl of 1/25 diluted cDNA with a CFX-96 (Biorad) thermocycler ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatant was mixed with sample loading buffer supplemented with 1% v/v 2-mercaptoethanol (BioRad, Cat #1610710). Sample was not heated to prevent aggregation of the GPCR ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... and eIF2B4 loci were amplified with the primer pairs detailed in Table 4 and run on a 1% agarose gel and imaged using a ChemiDoc XRS+ imaging system (Biorad). The expected WT fragment length for the eIF2B1 ...