Labshake search
Citations for Bio-Rad :
51 - 100 of 4015 citations for 6 4 Methoxybenzylcarbamoyl pyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Protein lysates from SH-SY5Y cells were quantified (bicinchoninic acid protein assay, Pierce) and then electrophoresed in 4—12% Mini-PROTEAN® TGX™ Precast Gels (Bio-Rad) in 1X TGS Tris/Glycine/SDS Buffer (10X TGS Buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Marcy l’Etoile, France), sheep blood agar with colistin and nalidixic acid (CNA, bioMérieux) and chromogenic agar (Uriselect 4, Bio-Rad, Marnes-la-Coquette, France). Bacterial growth was determined after 18 h of incubation at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were separated on 6-10 % SDS-polyacrylamide gels or 4-20 % Mini-PROTEAN TGX precast gradient gels (Bio-Rad, CA, USA) together with Precision Plus Protein Dual Color Standards (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Immunology 2020Quote: ... Samples were heated at 95°C for 3 minutes and run on a 8 – 16% or 4 – 20% TGX-Criterion gel (Bio-Rad). The separated proteins were transferred to PVDF membranes and blocked in PBS containing 0.2% fish skin gelatin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Cell Biology 2019Quote: ... The bicinchoninic acid assay (Bio-Rad) was used to measure protein concentration from the cell lysates and 20 μg of protein was loaded onto 8% SDS gels and electrophoresed ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Neuroscience 2019Quote: ... were heated at 99 °C for 3 minutes and subjected to 4-20% gradient SDS-PAGE prior to transfer to nitrocellulose membranes (Bio-Rad Laboratories, Inc.). Membranes were then blocked for 1 hour with 5% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... for DpnII digested DNA or primers 3 and 4 (table S3) for NlaIII digested DNA on a thermal cycler (Bio-Rad C1000 Touch) with the block settings shown in table 1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... for DpnII digested DNA or primers 3 and 4 (table S2) for NlaIII digested DNA on a thermal cycler (Bio-Rad C1000 Touch). PCR amplified samples were purified using the NucleoSpin Gel and PCR cleanup kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2022Quote: ... the indicated ESA supernatant was boiled in SDS-PAGE sample buffer and 3 μg of each sample was run with a 4-15% TGX gradient gel (Bio-Rad cat. no. 4561086), then transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cancer Biology 2021Quote: ... 4-15% Tris-HCI 4 SDS-PAGE gels (Bio-Rad), separated at 120V ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Biochemistry 2024Quote: ... 4-20% (BioRad), or 6% (Thermofisher ...
-
bioRxiv - Microbiology 2020Quote: Surface Plasmon Resonance (SPR) binding experiments were carried out on a ProteOn XPR36 6×6 channels protein interaction array system (Bio-Rad). Proteins BRD4-BD1 an BRD4-BD2 were diluted to a final concentration of 50μg/ml in HEPES buffer 25 mM pH 7.0 and immobilized to a GLM chip using amine coupling ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... pH6.9 using a micro biospin 6 column (Bio-Rad). The FOS sample was diluted to ∼500 µM with 0.5 M ammonium acetate ...
-
bioRxiv - Microbiology 2020Quote: ... and Bio-Plex Manager software (v.6, Bio-Rad). The data were expressed as median fluorescence intensity (MFI ...
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... 4 μl of the eluate was analyzed by 4-20% SDS PAGE (Biorad) and silver staining ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: Protein bands intensities were quantified with Image Lab 6 (BioRad). Equal rectangles were drawn around the total protein gel lane and the band of interest ...
-
bioRxiv - Biochemistry 2019Quote: ... BioSpin 6 desalting columns were purchased from BioRad (Hercules, CA). Diethylamine NONOate (DEA NONOate) ...