Labshake search
Citations for Bio-Rad :
401 - 450 of 6206 citations for 6 4 METHYLPIPERAZIN 1 YL NICOTINONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Microbiology 2022Quote: ... Resulting lipopolysaccharides were separated using gradient 4–20% sodium dodecyl sulfate□polyacrylamide gel (4–20% Mini□PROTEAN® TGX™ Precast Protein Gel, BioRad, Hercules, USA) electrophoresis (SDS□PAGE ...
-
bioRxiv - Neuroscience 2023Quote: 15-20 µg of protein were loaded onto 4-12% Bis-Tris gels (Novex, Cat. no: NP0336BOX) or 4-20% Tris-Glycine extended gels (BIO-RAD, Cat. no: 4561095) for separation and transferred to nitrocellulose or methanol activated PVDF membranes ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were run on 4-20% gradient gels (BioRad 4561096).
-
bioRxiv - Biophysics 2021Quote: ... Purity was confirmed by SDS-PAGE (4 – 20% TGX, BioRad).
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were loaded to 4-15% polyacrylamide gels (Bio-Rad) for electrophoresis ...
-
bioRxiv - Cancer Biology 2021Quote: ... and separated on 4-15% Protein Gels (BioRad, Cat# 4568084). SPOP protein was probed by using in-house made rabbit anti-SPOP (1:1000) ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples underwent electrophoresis on 4-15% gradient polyacrylamide gels (BioRad) and were immunoblotted with Rabbit anti-ADAM17 (CST ...
-
bioRxiv - Genetics 2021Quote: ... ran on a 4%-20% polyacrylamide gel (Bio-Rad, #4561096), and transferred to an Immobilon-P polyvinylidene fluoride (PVDF ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were loaded onto a 4-12% polyacrylamide gel (BioRad) and electrophoresed at 150V for 10 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... lysates were loaded on 4%–20% polyacrylamide gels (Bio-Rad) and transferred onto a nitrocellulose membrane (Whatman ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°C in a Mini Trans-Blot Cell (Bio-Rad). Membranes were blocked in 3% non-fat dry milk in TBS-T buffer for 30 min at room temperature ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: ... 4–20% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad) with Tris/Glycine/SDS running buffer (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: Western blotting was performed with 4-20% SDS-PAGE (Biorad), followed by immunoblotting with the following antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... were loaded onto a 4-20% TGX precast gel (BioRad) and the gel was run for 30 minutes at 200 V using a running buffer that was 0.5% Tris ...
-
bioRxiv - Biophysics 2019Quote: ... or 4-20% tris-glycine gels (Bio-Rad, 456-1096). Denaturing PAGE of oligonucleotides and their conjugates was performed with Novex 15% TBE-Urea gels (Life Technologies ...
-
bioRxiv - Systems Biology 2019Quote: ... proteins separated by 4∼20% gradient SDS-PAGE gels (Biorad) were transferred to nitrocellulose membranes ...
-
bioRxiv - Bioengineering 2021Quote: ... Proteins were resolved on 4 – 20% SDS-PAGE gels (BioRad), transferred to a PVDF membrane (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... and cooled to 4°C using a thermal cycler (Biorad). Next ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein samples were separated via 4-15% SDS PAGE (BioRad) and transferred to a PVDF membrane using the BioRad Turboblot system ...
-
bioRxiv - Neuroscience 2019Quote: ... was loaded into 4-15% Criterion TGX gels (BioRad, #5671085) and run at 200 V for 50 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were run on 4-20% Tris Glycine gels (BioRad) and transferred via Wet transfer onto PVDF membranes for immunoblotting with the indicated antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated in 4-20% SDS-PAGE gels (BioRad) and transferred to nitrocellulose membranes using Trans-Blot® Turbo™ system (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... then separated using 4-15% gradient SDS-PAGE (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... SDS-PAGE was performed using 4-20% polyacrylamide gels (BioRad) electrophoresed at 120V for 60 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-20% Criterion TGX Stain-Free Precast gels (BioRad) in Tris/Glycine/SDS running buffer (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were fractionated on a 4-15% gel (BioRad) and the gels were stained using PageBlue protein staining solution (Fermentas).
-
bioRxiv - Microbiology 2020Quote: ... Protein samples were mixed with 4× Laemmli buffer (Bio-Rad), denatured at 70°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were run on a 4-15% PAA gel (BioRad) under reducing conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... and densitometry performed using Image Lab software (ver 4, BioRad)
-
bioRxiv - Cell Biology 2022Quote: ... Samples were run on 4-15% gradient gels (Bio-Rad) at 80-120V and transferred onto PVDF membrane (Immobilon-FL ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded on 4-20% CriterionTM TGXTM gels (Bio-Rad) and migration was performed in a 1X tris-glycine buffer (Bio-Rad ...
-
bioRxiv - Developmental Biology 2022Quote: ... hold at 4°C in a C1000 Thermal Cycler (Biorad). We then performed RT-qPCR for gene expression quantification of the following genes ...
-
bioRxiv - Immunology 2022Quote: ... 4–20% Tris/glycine gels (Bio-Rad, Hercules, CA, USA), as described previously [25 ...
-
bioRxiv - Cancer Biology 2022Quote: ... separated on 4–20% polyacrylamide gradient gels (Bio-Rad Laboratories), and transferred onto nitrocellulose membranes (Bio-Rad Laboratories) ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4-15% mini PROTEAN Tris-Glycine gel (Bio-Rad), and the gel was transferred to a nitrocellulose membrane by using wet transfer for 3 h at 90 mV or transfer for 10 min at 20 mV with Invitrogen iblot 2 gel transfer device ...