Labshake search
Citations for Bio-Rad :
51 - 100 of 4394 citations for 5 NAPHTHALEN 1 YL 2H PYRAZOL 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Wako Chemicals) in Tris-MOPS running buffer (Wako Chemicals guidebook) for 2h at 100V using a Mini-PROTEAN® Tetra system (Bio-Rad Laboratories). After migration ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We used 1 μL diluted cDNA (1:3 in ddH2O) and iTaq Universal SYBR Green Supermix (Bio-rad) in the Bio-rad CFX96 real-time PCR detection system for qPCR experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse primer: 5’-GCAGAAGAAGCAGACACAGC-3’) were PCR amplified and monitored using a CFX96 Touch Real-Time PCR detection system (Bio-Rad). Relative expression of PHETA1 transcripts was normalized to the expression of POLR2A and analyzed using standard delta delta Ct method ...
-
bioRxiv - Microbiology 2020Quote: ... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... were incubated in TBS-T/milk for 45 min and washed 3 × 5 min with TBS-T before detecting using a Chemidoc imager (Bio-Rad). NearIR-conjugated secondary antibodies (LI-COR Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... were amplified by PCR using 5’ and 3’ primers with overhangs containing T7 binding sites using iProof High-Fidelity Taq (Bio-Rad). PCR reaction products were run on an agarose gel to check for the correct amplicon ...
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were washed in 1X PBS with 0.1% Tween 3 times for 5 minutes each before scanning using the ChemiDoc™ MP Imaging System (Bio-Rad). Note ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times for 5 min with TBS and were subsequently incubated with Clarity Western ECL substrate working solution (Bio-Rad) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was developed with Clarity Max Western ECL Substrate (Bio-Rad) for 1 minute before imaging ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The membrane was washed 3 times with TBST for 5 min each and then the membrane was incubated with Clarity Western ECL Substrate (Bio-Rad) for 2 min before exposure to film and development in a darkroom.
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was developed with Clarity Max Western ECL Substrate (Bio-Rad) for 1 minute before imaging ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were mixed with Bradford reagent (1:5; Bio-Rad) and absorbance was measured at 595 nm ...
-
bioRxiv - Molecular Biology 2024Quote: ... were used at 1:5000 in 5% Blotting-Grade Blocker (BioRad).
-
bioRxiv - Immunology 2023Quote: ... cDNA was diluted 1:5 (for caecum 1:1 or 1:10) and qPCR was performed on a CFX384 Touch™ (Bio-Rad) with iTaq Universal SYBR (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... Membranes were then washed 3 times for 5 min in TBST before detection using Clarity Western ECL Substrate (Bio-rad, 170-5061) and imaging on a ChemiDoc MP (Bio-rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... carried out in glass tubes filled with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (Bio-Rad, USA) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Electrofocusing was performed in glass capillaries with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (#163-1112, #163-1192, Bio-Rad, USA). The second direction is standard SDS 5-10% PAGE followed by staining with Coomassie Brilliant Blue G-250 (#31-4-58-1 ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL diluted cDNA (5 ng) in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each experimental sample (four source colonies ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubated for 1 h with 5% blotting grade blocker (Bio-Rad). Primary antibodies were incubated overnight at 4℃ and secondary HRP-conjugated antibodies were incubated for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... After 1 h blocking (5% non-fat milk, Bio-Rad 170–6404) at room temperature (RT) ...
-
bioRxiv - Cell Biology 2020Quote: ... at 100V for 1 hour and blocked for 1 hour with 5% non-fat milk (Bio-Rad) before incubation at 4 C overnight with appropriate primary antibodies ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% FBS for 1 hour and incubated with anti TGN46 antibody (#AHP500GT, BioRad, 1:2000) at 4°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Plant Biology 2020Quote: ... we used 2 µl of a 1/5 dilution of the cDNA obtained as above in a reaction containing 5 µl of SsoFast EvaGreen (Bio-Rad, USA), 0.5 µl of Forward primer (10 µM ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2019Quote: ... After being blocked with TBST (1%) containing 5% blotting-grade blocker (Bio-Rad), the membranes were incubated overnight with primary antibodies against target molecules at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked in 5% nonfat dry milk for 1 hour (Bio-Rad) and incubated gently shaking overnight at 4°C in 1° antibody/PBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... and blocked for 1 h with 5% non-fat milk (Bio-Rad Laboratories) or BSA (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked for 1 h with 5% nonfat milk powder (Bio-Rad) in TBS + 0.05% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% Tween]) or for 5 min in EveryBlot blocking buffer (Bio-Rad, #12010020) before proceeding to primary and HRP secondary antibody staining in the respective blocking buffers ...
-
bioRxiv - Microbiology 2023Quote: ... sheep polyclonal anti-GFP (Bio-Rad, 4745-1051, 1:1000, 5 µg/mL), and rabbit polyclonal anti-GFP (Novus Biologicals ...
-
bioRxiv - Systems Biology 2021Quote: ... incubated 5 min at 65 °C and separated by 12% SDS-PAGE (65) in the Mini Protean 3 Apparatus (BioRad Laboratories, Hercules, CA, USA). The final concentration of proteins was 10 μg per lane ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the miR200c primers (upstream primer, 5’- TAATACTGCCGGGTAATGATGGA-3’) (Eurofins Genomics) on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). U6 primers (TAKARA ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...