Labshake search
Citations for Bio-Rad :
1 - 50 of 5281 citations for 5 Hydroxytryptophan 5 HTP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Cell Biology 2023Quote: ... Assembled chromatin was applied to a hydroxyapatite column (Bio-Rad HTP) with 0.1 M NaCl ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bio-Gel® HTP Hydroxyapatite (1300420, Lot 64079675) was obtained from Bio-Rad Laboratories.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Biophysics 2023Quote: ... Core histones were purified using a hydroxyapatite Bio-gel HTP gel slurry (Bio-Rad Laboratories) as previously described65 but with the omission of MNase digestion before fractionation ...
-
bioRxiv - Microbiology 2020Quote: ... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Biophysics 2019Quote: ... containing 5% 2-mercaptoethanol (Bio-Rad), electrophoresed by SDS-PAGE and blotted onto nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... A hydroxyapatite column was prepared by resuspending 2 g Bio-Gel HTP Hydroxyapatite (Bio-Rad, 130-0420) in 12 ml CDC6 HTP-wash buffer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane blots were blocked in 5% blocking buffer (5% non-fat dry milk, Bio-Rad, in TBST) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad) for 1 hour at room temp ...
-
bioRxiv - Molecular Biology 2019Quote: ... which was blocked with 5% milk (BioRad, Hercules ...
-
bioRxiv - Physiology 2019Quote: ... and an iQTM 5 System (Bio-Rad) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were blocked in 5% milk (BioRad) and incubated with antibodies for BMAL-1 (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Blocking solution contained 5% milk powder (BioRad) in Tris-buffered saline containing 0.2% Tween 20 ...
-
bioRxiv - Microbiology 2021Quote: ... resolved by 5% TBE gel (Bio-Rad), and visualized using an Odyssey infrared imager (LI-COR Biosciences).
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% β-Mercaptoethanol (BioRad 1610710) and heated for 10 min at 100°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad)) for 1 hour at room temp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked in 5% Milk (BioRad) in 1XTBS-T and incubated overnight in primary antibodies diluted in 5% milk at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... blocked with 5% blocking protein (Bio-Rad) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 5 second interval (Bio-Rad Gene Pulser Xcell Electroporation Systems) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5% β-mercaptoethanol (Bio-Rad Laboratories) and boiling sample for 7 minutes followed by western blot analysis.
-
bioRxiv - Immunology 2020Quote: ... 5-μg/mL of sheep IgG (Biorad) and purified TNP (BD Pharmingen) ...
-
bioRxiv - Physiology 2023Quote: ... 5 μl SYBR Green mastermix (iTaq, Biorad) and 4 μl cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in 5% blocking buffer (Bio-Rad), blotted in primary and secondary antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... + 5 % βmercapto-ethanol (BioRad ref #161-0710), and heated for 5 min at 70°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-phospho-p38 MAPK (Thr180/Tyr182 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... After blocking with 5% BSA (BIO-RAD) in 1 X PBS at room temperature for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantum™ FITC-5 MESF beads (BioRad) were used according to the manufacturer’s protocol to estimate the length of telomeres quantitatively ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of total RNA was reverse transcribed using the iScript Advanced cDNA Synthesis Kit (BioRad, USA) in a 10 µL volume ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 mM EGTA) and protein concentrations were determined by DC protein assay kit II (Bio-Rad #5000112). Proteins were separated on house-made SDS-PAGE gels and transferred to nitrocellulose membranes (Amersham #10600003) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...