Labshake search
Citations for Bio-Rad :
1 - 50 of 1484 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Microbiology 2022Quote: ... anti-alpha-Tubulin (VMA00051, BIO-RAD), anti-Lamin B1 (66095-1-Ig ...
-
bioRxiv - Cell Biology 2020Quote: ... alpha-Tubulin (BioRad MCA78G, 1:2000), Cdc20 (Santa Cruz sc-8358 ...
-
bioRxiv - Cell Biology 2023Quote: ... we used primary alpha-tubulin rat antibody (Bio-rad) diluted 1:200 in 1% BSA in PBS for 1.5 hours at room temperature and secondary antibody anti-rat Alexa Fluor 647 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... a rat monoclonal anti-alpha tubulin (1:2000, MCA77G, Bio-Rad), a rat anti-GFP antibody (1:500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Tub1 (rat monoclonal anti-tubulin alpha, (Bio-Rad Cat# MCA77G, RRID:AB_325003)) (1:10000 dilution each in PBS-T) ...
-
bioRxiv - Cell Biology 2020Quote: ... the process was repeated with an alpha-tubulin antibody (BioRad MCA78G, 1:2000) to minimize cross-reaction ...
-
bioRxiv - Immunology 2023Quote: ... and rabbit anti-alpha actinin-1 at 1:1000 (Bio-Rad Laboratories #VPA00889). Membranes were washed with TBS-T and then incubated with HRP-conjugated secondary antibodies for 1 h at RT ...
-
bioRxiv - Immunology 2020Quote: ... We used FITC-conjugated mouse anti-pig CD4 alpha (clone MIL17, Bio-Rad AbD Serotec, Puchheim, Germany, 1:20) and Alexa Fluor 647-conjugated mouse anti-pig CD8α (clone 76-2-11 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were blocked for 1hr in PBS with 1mg/ml and 0.1% triton and then stained overnight with anti-alpha Tubulin antibody (1:100, MCA78G, BioRad). Cells were then washed ...
-
bioRxiv - Neuroscience 2020Quote: ... 20μL reactions were prepared in triplicate in 96-well white plates (Alpha Laboratories, UK) consisting of 10μL iTaq™ Universal SYBR® Green Supermix (BioRad), 1μL 20x TaqMan gene expression assay ...
-
bioRxiv - Cell Biology 2022Quote: ... and imaged either with MultiImage Light Cabinet using FluorChem 8900 software (Alpha Innotech Corporation, San Leandro, CA, USA) or Gel Doc XR+ System with Image Lab Software (Bio-Rad). Coomassie staining with Colloidal Blue staining kit (Thermo Fisher Scientific Cat# LC6025 ...
-
bioRxiv - Microbiology 2024Quote: To quantify endogenous chicken ZC3HAV1 and TUBA4A mRNA transcripts in shRNA-expressing stable cells following chicken interferon-alpha treatment (1000U/mL; Bio-Rad) for 24 hours ...
-
bioRxiv - Plant Biology 2020Quote: ... The reactions were carried out in a thermal cycler (Single Block Alpha Unit, DNA Engine®, Bio-Rad Laboratories, Berkeley, CA, USA) with an annealing temperature of 55 °C ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Immunology 2020Quote: ... a total of 6 × 107 cells was incubated in staining buffer with mouse anti-pig CD4 alpha (clone MIL17, Bio-Rad AbD Serotec, Puchheim, Germany, 1:50) at 4°C for 20 min ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% non-fat milk (Bio-Rad) was used as the blocking agent for primary antibodies detecting non-phosphorylated proteins and all horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam ...
-
What challenges remain in harmonizing cytomegalovirus viral load quantification across laboratories?bioRxiv - Microbiology 2024Quote: ... (iv) 5 duplicates from Bio-Rad’s Exact Diagnostics Verification Panel 1.4 mL (CMVP200 ...
-
bioRxiv - Cell Biology 2024Quote: ... blocked in 5% milk (1706404, BioRad) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane blots were blocked in 5% blocking buffer (5% non-fat dry milk, Bio-Rad, in TBST) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad) for 1 hour at room temp ...
-
bioRxiv - Neuroscience 2020Quote: ... Blocking solution contained 5% milk powder (BioRad) in Tris-buffered saline containing 0.2% Tween 20 ...
-
bioRxiv - Microbiology 2021Quote: ... resolved by 5% TBE gel (Bio-Rad), and visualized using an Odyssey infrared imager (LI-COR Biosciences).
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% β-Mercaptoethanol (BioRad 1610710) and heated for 10 min at 100°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad)) for 1 hour at room temp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked in 5% Milk (BioRad) in 1XTBS-T and incubated overnight in primary antibodies diluted in 5% milk at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... blocked with 5% blocking protein (Bio-Rad) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 5 second interval (Bio-Rad Gene Pulser Xcell Electroporation Systems) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5% β-mercaptoethanol (Bio-Rad Laboratories) and boiling sample for 7 minutes followed by western blot analysis.
-
bioRxiv - Immunology 2020Quote: ... 5-μg/mL of sheep IgG (Biorad) and purified TNP (BD Pharmingen) ...
-
bioRxiv - Physiology 2023Quote: ... 5 μl SYBR Green mastermix (iTaq, Biorad) and 4 μl cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in 5% blocking buffer (Bio-Rad), blotted in primary and secondary antibodies ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... + 5 % βmercapto-ethanol (BioRad ref #161-0710), and heated for 5 min at 70°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-phospho-p38 MAPK (Thr180/Tyr182 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...